Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208206592:

Variant ID: vg0208206592 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8206592
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTAGAAGTAAATTAGATTTAGGCTGTGTCTAGTTCACACCAAAATTGAAAGTTTGGTTGAAATTAGAACGATGTGATGGAAAAGTTGAAAGTTTATGT[A/G]
TGTAGGAAAGTTTTGATGTGATGGAAAAGTGGAAGTTTTTTAAAAAAGTTTGGTACTAAACAAGGTGTTAGCATACAACTCATAATTCTATTCTTACATA

Reverse complement sequence

TATGTAAGAATAGAATTATGAGTTGTATGCTAACACCTTGTTTAGTACCAAACTTTTTTAAAAAACTTCCACTTTTCCATCACATCAAAACTTTCCTACA[T/C]
ACATAAACTTTCAACTTTTCCATCACATCGTTCTAATTTCAACCAAACTTTCAATTTTGGTGTGAACTAGACACAGCCTAAATCTAATTTACTTCTACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.60%	0.15%	0.00%	NA
All Indica	2759	74.10%	25.70%	0.18%	0.00%	NA
All Japonica	1512	70.40%	29.50%	0.13%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	69.70%	30.10%	0.17%	0.00%	NA
Indica II	465	87.10%	12.90%	0.00%	0.00%	NA
Indica III	913	69.10%	30.80%	0.11%	0.00%	NA
Indica Intermediate	786	75.60%	24.00%	0.38%	0.00%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	30.20%	69.40%	0.40%	0.00%	NA
Japonica Intermediate	241	72.20%	27.80%	0.00%	0.00%	NA
VI/Aromatic	96	60.40%	39.60%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208206592	A -> G	LOC_Os02g14790.1	upstream_gene_variant ; 199.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14800.1	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14800.4	upstream_gene_variant ; 3003.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14800.5	upstream_gene_variant ; 3003.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14800.2	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14800.3	upstream_gene_variant ; 3004.0bp to feature; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N
vg0208206592	A -> G	LOC_Os02g14790-LOC_Os02g14800	intergenic_region ; MODIFIER	silent_mutation	Average:62.501; most accessible tissue: Minghui63 flag leaf, score: 74.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208206592	NA	4.36E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	NA	9.15E-06	mr1448	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	NA	7.97E-07	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	NA	9.52E-07	mr1701	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	6.02E-06	6.01E-06	mr1703	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	NA	2.09E-07	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208206592	NA	1.41E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251