Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208200175:

Variant ID: vg0208200175 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8200175
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGGGCAATGCTAGAAAGTCTTACTTATGAAACAGAGGAAGTATATTGACTTGTTGATGATGCTCCTGATGTTAAAATTCTTCCTTTGACAGAATAGCA[T/C]
GGTTATCCATTAGATCGCTGCTGCTGGAATATTTTATGAAATAGGAAAAGCTTTTAGTTGAAGGCTTAATTATGTATTTTCTCTACCTTCATTGGTCTAA

Reverse complement sequence

TTAGACCAATGAAGGTAGAGAAAATACATAATTAAGCCTTCAACTAAAAGCTTTTCCTATTTCATAAAATATTCCAGCAGCAGCGATCTAATGGATAACC[A/G]
TGCTATTCTGTCAAAGGAAGAATTTTAACATCAGGAGCATCATCAACAAGTCAATATACTTCCTCTGTTTCATAAGTAAGACTTTCTAGCATTGCCCACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	37.90%	0.25%	0.00%	NA
All Indica	2759	54.00%	45.70%	0.36%	0.00%	NA
All Japonica	1512	69.20%	30.70%	0.07%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	68.20%	31.40%	0.34%	0.00%	NA
Indica II	465	55.70%	44.30%	0.00%	0.00%	NA
Indica III	913	42.60%	57.10%	0.33%	0.00%	NA
Indica Intermediate	786	55.30%	44.00%	0.64%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	27.60%	72.40%	0.00%	0.00%	NA
Japonica Intermediate	241	71.40%	28.20%	0.41%	0.00%	NA
VI/Aromatic	96	59.40%	40.60%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208200175	T -> C	LOC_Os02g14780.2	3_prime_UTR_variant ; 624.0bp to feature; MODIFIER	silent_mutation	Average:50.621; most accessible tissue: Callus, score: 83.931	N	N	N	N
vg0208200175	T -> C	LOC_Os02g14780.1	downstream_gene_variant ; 363.0bp to feature; MODIFIER	silent_mutation	Average:50.621; most accessible tissue: Callus, score: 83.931	N	N	N	N
vg0208200175	T -> C	LOC_Os02g14790.1	downstream_gene_variant ; 4793.0bp to feature; MODIFIER	silent_mutation	Average:50.621; most accessible tissue: Callus, score: 83.931	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208200175	NA	3.21E-07	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	8.94E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	1.69E-07	1.68E-07	mr1703	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	4.72E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	4.51E-06	mr1955	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	3.58E-06	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	2.44E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208200175	NA	4.91E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251