Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208187191:

Variant ID: vg0208187191 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8187191
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAGTAAAATTGCATGTCATCTTGCTCTAGCGTCGTGAACAACATGAGATCCATTGGCAGATCTAGCGCGACAGTACCATGACTACCCCCGAGTAGTTG[C/T]
CCAAACTTACCGGCATATGGCAAGAGGTAGAAATACATTGTTATTGGTATCTGATAATGCCGGTGCATGTCAAGACTCAAGATGTAGAGAAATACCTCAT

Reverse complement sequence

ATGAGGTATTTCTCTACATCTTGAGTCTTGACATGCACCGGCATTATCAGATACCAATAACAATGTATTTCTACCTCTTGCCATATGCCGGTAAGTTTGG[G/A]
CAACTACTCGGGGGTAGTCATGGTACTGTCGCGCTAGATCTGCCAATGGATCTCATGTTGTTCACGACGCTAGAGCAAGATGACATGCAATTTTACTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 22.70% 2.90% 22.94% NA
All Indica  2759 36.00% 38.00% 4.06% 21.96% NA
All Japonica  1512 69.80% 0.50% 1.19% 28.51% NA
Aus  269 98.90% 0.00% 0.00% 1.12% NA
Indica I  595 15.80% 54.10% 6.05% 24.03% NA
Indica II  465 59.10% 28.00% 3.01% 9.89% NA
Indica III  913 34.30% 34.40% 2.74% 28.59% NA
Indica Intermediate  786 39.60% 35.90% 4.71% 19.85% NA
Temperate Japonica  767 95.20% 0.90% 0.26% 3.65% NA
Tropical Japonica  504 29.60% 0.20% 1.98% 68.25% NA
Japonica Intermediate  241 73.00% 0.00% 2.49% 24.48% NA
VI/Aromatic  96 62.50% 0.00% 4.17% 33.33% NA
Intermediate  90 63.30% 20.00% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208187191 C -> T LOC_Os02g14770.1 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N
vg0208187191 C -> T LOC_Os02g14770.3 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N
vg0208187191 C -> T LOC_Os02g14770.4 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N
vg0208187191 C -> T LOC_Os02g14770.2 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N
vg0208187191 C -> T LOC_Os02g14770-LOC_Os02g14780 intergenic_region ; MODIFIER silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N
vg0208187191 C -> DEL N N silent_mutation Average:63.197; most accessible tissue: Callus, score: 92.154 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208187191 C T 0.0 0.01 0.0 0.0 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208187191 NA 2.02E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208187191 NA 7.45E-08 mr1780 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208187191 NA 5.77E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251