Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208168116:

Variant ID: vg0208168116 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8168116
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGGTCTCAGGCTCATCACATTGTTTTTTAGATTATTTTTTTCAAAAAAGAACTAATCATATGATTTTCTTTTCCCTGTGGTACAGTAATATTGACCTG[C/A]
GACTGAGTTTGTGTATGTTCTATTCTCCAAGAGTCAAGCTGCTTAACATAATTGTCTTCCTAACTGTGCAGGTTACAGAAGAAGATGTAAAGATTTTCTT

Reverse complement sequence

AAGAAAATCTTTACATCTTCTTCTGTAACCTGCACAGTTAGGAAGACAATTATGTTAAGCAGCTTGACTCTTGGAGAATAGAACATACACAAACTCAGTC[G/T]
CAGGTCAATATTACTGTACCACAGGGAAAAGAAAATCATATGATTAGTTCTTTTTTGAAAAAAATAATCTAAAAAACAATGTGATGAGCCTGAGACCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.40%	16.50%	0.04%	0.00%	NA
All Indica	2759	72.70%	27.30%	0.00%	0.00%	NA
All Japonica	1512	98.90%	1.00%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.60%	5.40%	0.00%	0.00%	NA
Indica II	465	44.70%	55.30%	0.00%	0.00%	NA
Indica III	913	73.40%	26.60%	0.00%	0.00%	NA
Indica Intermediate	786	71.80%	28.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.00%	0.40%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208168116	C -> A	LOC_Os02g14770.1	downstream_gene_variant ; 4303.0bp to feature; MODIFIER	silent_mutation	Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621	N	N	N	N
vg0208168116	C -> A	LOC_Os02g14760.1	intron_variant ; MODIFIER	silent_mutation	Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621	N	N	N	N
vg0208168116	C -> A	LOC_Os02g14760.2	intron_variant ; MODIFIER	silent_mutation	Average:72.406; most accessible tissue: Minghui63 flag leaf, score: 83.621	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208168116	NA	4.71E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	3.81E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	4.71E-06	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	2.58E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	4.19E-13	mr1557	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	1.60E-10	mr1565	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	2.98E-08	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	2.68E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	1.08E-07	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208168116	NA	9.03E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251