Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208134492:

Variant ID: vg0208134492 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 8134492
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGACAATGTTGTTGACCGACGACGATCCTTCTTGTGCGGATTGGTGGTGTGGGTTTGGACAGGGAATCGCGGGCGAAAGCCTTGCCGAGCCATTTG[A/G]
CCGGCTGACAACGGCGACGCCGTTTGGCATCGTTCCCCTCCTTGGACGCGTTGTTTTTGCATACCCCTTTCGTTTCCCTACCATATTCTCCGGGTGAAAA

Reverse complement sequence

TTTTCACCCGGAGAATATGGTAGGGAAACGAAAGGGGTATGCAAAAACAACGCGTCCAAGGAGGGGAACGATGCCAAACGGCGTCGCCGTTGTCAGCCGG[T/C]
CAAATGGCTCGGCAAGGCTTTCGCCCGCGATTCCCTGTCCAAACCCACACCACCAATCCGCACAAGAAGGATCGTCGTCGGTCAACAACATTGTCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 23.00% 4.15% 0.00% NA
All Indica  2759 97.70% 1.30% 0.98% 0.00% NA
All Japonica  1512 32.20% 67.30% 0.53% 0.00% NA
Aus  269 54.60% 0.40% 44.98% 0.00% NA
Indica I  595 98.70% 0.80% 0.50% 0.00% NA
Indica II  465 97.20% 1.70% 1.08% 0.00% NA
Indica III  913 98.10% 1.20% 0.66% 0.00% NA
Indica Intermediate  786 96.70% 1.70% 1.65% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 72.00% 27.20% 0.79% 0.00% NA
Japonica Intermediate  241 33.20% 65.10% 1.66% 0.00% NA
VI/Aromatic  96 51.00% 12.50% 36.46% 0.00% NA
Intermediate  90 71.10% 23.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0208134492 A -> G LOC_Os02g14730.1 upstream_gene_variant ; 869.0bp to feature; MODIFIER silent_mutation Average:64.773; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N
vg0208134492 A -> G LOC_Os02g14720-LOC_Os02g14730 intergenic_region ; MODIFIER silent_mutation Average:64.773; most accessible tissue: Zhenshan97 flag leaf, score: 89.753 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0208134492 A G -0.03 -0.02 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0208134492 NA 1.55E-08 mr1531 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251