Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208050121:

Variant ID: vg0208050121 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8050121
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGAGTATACATATGCAGTTGTTTGGTTGGTTGCATTGGTCTAGCCAGGCTAGCATGAGATTTTGTTTGGTTACTTGTATAAGAGATACGGTTTGAAAG[G/A]
GATTTTGTTTGGTTGGTTGCATGGATGTGAGTGTTCTTTACCTCTTCATTTAGTTGGGTGAGGTTACCTCTACAATATATATAACAAATAATAAGAGTAT

Reverse complement sequence

ATACTCTTATTATTTGTTATATATATTGTAGAGGTAACCTCACCCAACTAAATGAAGAGGTAAAGAACACTCACATCCATGCAACCAACCAAACAAAATC[C/T]
CTTTCAAACCGTATCTCTTATACAAGTAACCAAACAAAATCTCATGCTAGCCTGGCTAGACCAATGCAACCAACCAAACAACTGCATATGTATACTCTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.30%	3.70%	0.99%	1.02%	NA
All Indica	2759	99.20%	0.00%	0.80%	0.04%	NA
All Japonica	1512	86.90%	11.20%	1.39%	0.53%	NA
Aus	269	98.50%	0.00%	0.37%	1.12%	NA
Indica I	595	97.80%	0.00%	2.18%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	0.00%	0.89%	0.13%	NA
Temperate Japonica	767	98.00%	0.70%	0.78%	0.52%	NA
Tropical Japonica	504	67.50%	29.40%	2.78%	0.40%	NA
Japonica Intermediate	241	92.10%	6.60%	0.41%	0.83%	NA
VI/Aromatic	96	71.90%	0.00%	0.00%	28.12%	NA
Intermediate	90	82.20%	4.40%	3.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208050121	G -> A	LOC_Os02g14590.1	upstream_gene_variant ; 1983.0bp to feature; MODIFIER	silent_mutation	Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0208050121	G -> A	LOC_Os02g14580.1	downstream_gene_variant ; 1995.0bp to feature; MODIFIER	silent_mutation	Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0208050121	G -> A	LOC_Os02g14580-LOC_Os02g14590	intergenic_region ; MODIFIER	silent_mutation	Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0208050121	G -> DEL	N	N	silent_mutation	Average:39.405; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208050121	3.29E-06	6.48E-06	mr1098_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	7.08E-06	NA	mr1150_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	NA	7.10E-08	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	NA	1.40E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	NA	4.18E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	9.80E-06	NA	mr1874_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208050121	NA	5.75E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251