Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0208020311:

Variant ID: vg0208020311 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 8020311
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCTTGATAAAAAAAATAGTTAATTACAACGTATCTAGTATGAAATTGTTATATAACTATTACATAACTAATAACTTATATGTAACTTGATCTTTTCTT[T/C]
CAAAACCACATGGCATTGCAAGTGCCTAGCGTAGCGGTCTTGCAAGCAACAAGTCAAGGGTTCAATTCTCGCTTGGGCACGTGCGATTTTTTTTTATATC

Reverse complement sequence

GATATAAAAAAAAATCGCACGTGCCCAAGCGAGAATTGAACCCTTGACTTGTTGCTTGCAAGACCGCTACGCTAGGCACTTGCAATGCCATGTGGTTTTG[A/G]
AAGAAAAGATCAAGTTACATATAAGTTATTAGTTATGTAATAGTTATATAACAATTTCATACTAGATACGTTGTAATTAACTATTTTTTTTATCAAGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.30%	22.50%	0.19%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.04%	0.00%	NA
All Japonica	1512	33.90%	65.70%	0.40%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	44.50%	54.80%	0.78%	0.00%	NA
Tropical Japonica	504	10.70%	89.30%	0.00%	0.00%	NA
Japonica Intermediate	241	48.50%	51.50%	0.00%	0.00%	NA
VI/Aromatic	96	75.00%	25.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	26.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0208020311	T -> C	LOC_Os02g14540.1	upstream_gene_variant ; 956.0bp to feature; MODIFIER	silent_mutation	Average:45.8; most accessible tissue: Callus, score: 91.623	N	N	N	N
vg0208020311	T -> C	LOC_Os02g14530.1	downstream_gene_variant ; 2967.0bp to feature; MODIFIER	silent_mutation	Average:45.8; most accessible tissue: Callus, score: 91.623	N	N	N	N
vg0208020311	T -> C	LOC_Os02g14550.1	downstream_gene_variant ; 1630.0bp to feature; MODIFIER	silent_mutation	Average:45.8; most accessible tissue: Callus, score: 91.623	N	N	N	N
vg0208020311	T -> C	LOC_Os02g14540-LOC_Os02g14550	intergenic_region ; MODIFIER	silent_mutation	Average:45.8; most accessible tissue: Callus, score: 91.623	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0208020311	NA	7.37E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	8.82E-06	7.86E-22	mr1122	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	NA	2.40E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	NA	2.32E-17	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	NA	2.34E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	NA	7.29E-12	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0208020311	NA	1.53E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251