Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207900353:

Variant ID: vg0207900353 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7900353
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCGCCTGTCCTCATCATGGGATGGACGACTAGCTGATCCTAGAGAATTTTTACAATTGTCTCACCCCAATGTCCCGTGATCACCTGGACGCGGTAGCT[G/A]
GAGGAGCTTTCTTCTCTAAAACGGTTCAAGGAGCCGTTGAACTCATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAAGAACGACTCCAAACCTGTTA

Reverse complement sequence

TAACAGGTTTGGAGTCGTTCTTCGCTCCAACCCATATTGGAGACCATCTTCTCTATGAGTTCAACGGCTCCTTGAACCGTTTTAGAGAAGAAAGCTCCTC[C/T]
AGCTACCGCGTCCAGGTGATCACGGGACATTGGGGTGAGACAATTGTAAAAATTCTCTAGGATCAGCTAGTCGTCCATCCCATGATGAGGACAGGCGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.80%	36.40%	1.61%	6.24%	NA
All Indica	2759	91.00%	5.90%	0.65%	2.39%	NA
All Japonica	1512	2.60%	97.30%	0.07%	0.07%	NA
Aus	269	14.10%	3.00%	7.43%	75.46%	NA
Indica I	595	98.00%	1.30%	0.34%	0.34%	NA
Indica II	465	89.00%	3.70%	2.15%	5.16%	NA
Indica III	913	89.20%	8.90%	0.44%	1.53%	NA
Indica Intermediate	786	89.20%	7.30%	0.25%	3.31%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.10%	0.41%	0.41%	NA
VI/Aromatic	96	6.20%	41.70%	33.33%	18.75%	NA
Intermediate	90	45.60%	41.10%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207900353	G -> A	LOC_Os02g14390.1	upstream_gene_variant ; 108.0bp to feature; MODIFIER	silent_mutation	Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0207900353	G -> A	LOC_Os02g14380.1	downstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0207900353	G -> A	LOC_Os02g14380-LOC_Os02g14390	intergenic_region ; MODIFIER	silent_mutation	Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N
vg0207900353	G -> DEL	N	N	silent_mutation	Average:25.605; most accessible tissue: Zhenshan97 flag leaf, score: 70.837	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207900353	NA	1.70E-10	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	7.11E-16	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	3.54E-15	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	2.19E-17	mr1326_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	1.72E-15	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	1.29E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	1.29E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	5.49E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	5.03E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	7.02E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207900353	NA	1.02E-17	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251