Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207521328:

Variant ID: vg0207521328 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7521328
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGCTTTTTGGTAGAATATGAGCGATGCCAACACAATGGATGACCACATATCGATCTGGGCAGGGAAAAACCTAAATGGCAAAGTTACCAATCATCATT[A/G]
TACTAGTAAATTACCGATATACCCTTAATAACGAATGGTACCGGTAGAGAGCACCGGTGCATCACTCATCGGGAAAAACATTAGCGATGTAGGGGTGGAA

Reverse complement sequence

TTCCACCCCTACATCGCTAATGTTTTTCCCGATGAGTGATGCACCGGTGCTCTCTACCGGTACCATTCGTTATTAAGGGTATATCGGTAATTTACTAGTA[T/C]
AATGATGATTGGTAACTTTGCCATTTAGGTTTTTCCCTGCCCAGATCGATATGTGGTCATCCATTGTGTTGGCATCGCTCATATTCTACCAAAAAGCCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	22.80%	0.13%	4.08%	NA
All Indica	2759	91.00%	1.90%	0.18%	6.89%	NA
All Japonica	1512	35.90%	64.00%	0.07%	0.07%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	89.50%	1.50%	0.43%	8.60%	NA
Indica III	913	85.30%	3.10%	0.22%	11.39%	NA
Indica Intermediate	786	92.10%	1.90%	0.13%	5.85%	NA
Temperate Japonica	767	13.70%	86.30%	0.00%	0.00%	NA
Tropical Japonica	504	55.80%	43.80%	0.20%	0.20%	NA
Japonica Intermediate	241	65.10%	34.90%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207521328	A -> G	LOC_Os02g13870.1	upstream_gene_variant ; 1992.0bp to feature; MODIFIER	silent_mutation	Average:53.47; most accessible tissue: Zhenshan97 young leaf, score: 73.54	N	N	N	N
vg0207521328	A -> G	LOC_Os02g13880.1	downstream_gene_variant ; 2978.0bp to feature; MODIFIER	silent_mutation	Average:53.47; most accessible tissue: Zhenshan97 young leaf, score: 73.54	N	N	N	N
vg0207521328	A -> G	LOC_Os02g13870-LOC_Os02g13880	intergenic_region ; MODIFIER	silent_mutation	Average:53.47; most accessible tissue: Zhenshan97 young leaf, score: 73.54	N	N	N	N
vg0207521328	A -> DEL	N	N	silent_mutation	Average:53.47; most accessible tissue: Zhenshan97 young leaf, score: 73.54	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207521328	NA	3.53E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	NA	1.64E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	NA	4.82E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	NA	3.51E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	4.80E-06	4.80E-06	mr1630	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	NA	5.03E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207521328	NA	8.56E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251