Variant ID: vg0207313113 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 7313113 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAATGTTATTGATCATTCTTTTTCTGAAGAGTAATGCTATTGATTATTCTACTGGATCTTGCCTTTAGCTTGGCACAATGTTCATTAAGCCCTCTGTGT[G/A]
TAATCCCCCCCCCCCCACCCAACCAAAAAAAAAAAGGGGAAACAGAAGGCCGCAAATTTTGCATTTGATAACCTGAAAAGTTTGAGCATTAATATTTTAT
ATAAAATATTAATGCTCAAACTTTTCAGGTTATCAAATGCAAAATTTGCGGCCTTCTGTTTCCCCTTTTTTTTTTTGGTTGGGTGGGGGGGGGGGGATTA[C/T]
ACACAGAGGGCTTAATGAACATTGTGCCAAGCTAAAGGCAAGATCCAGTAGAATAATCAATAGCATTACTCTTCAGAAAAAGAATGATCAATAACATTCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.20% | 7.00% | 1.33% | 0.44% | NA |
All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.07% | NA |
All Japonica | 1512 | 73.50% | 21.30% | 3.97% | 1.26% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 73.80% | 23.70% | 2.35% | 0.13% | NA |
Tropical Japonica | 504 | 73.80% | 15.30% | 7.54% | 3.37% | NA |
Japonica Intermediate | 241 | 71.80% | 26.10% | 1.66% | 0.41% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0207313113 | G -> A | LOC_Os02g13640.1 | upstream_gene_variant ; 3275.0bp to feature; MODIFIER | silent_mutation | Average:35.609; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg0207313113 | G -> A | LOC_Os02g13620.1 | downstream_gene_variant ; 2121.0bp to feature; MODIFIER | silent_mutation | Average:35.609; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg0207313113 | G -> A | LOC_Os02g13630.1 | downstream_gene_variant ; 985.0bp to feature; MODIFIER | silent_mutation | Average:35.609; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg0207313113 | G -> A | LOC_Os02g13620-LOC_Os02g13630 | intergenic_region ; MODIFIER | silent_mutation | Average:35.609; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
vg0207313113 | G -> DEL | N | N | silent_mutation | Average:35.609; most accessible tissue: Zhenshan97 young leaf, score: 48.658 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0207313113 | NA | 7.23E-06 | mr1219 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207313113 | NA | 1.33E-06 | mr1201_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207313113 | 4.96E-06 | 6.64E-08 | mr1219_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0207313113 | 8.11E-07 | 4.19E-08 | mr1274_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |