Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207304262:

Variant ID: vg0207304262 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7304262
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGTGTGATTATGGTGAATAAGAGCAACGACCGGCTTCGGCCAACAGGATGTAGGGCTATTACCTGTCAGATAAGGGGTCCGAACTTGTATAAAAATCCT[C/T]
GCCTCCGTCTTTTTTACCTCAATCTCGCATATATCTTAGTACCAACGATCCCCATACTATACAAATACCGGAATCGCGACATTAAACGTCGACAATTACA

Reverse complement sequence

TGTAATTGTCGACGTTTAATGTCGCGATTCCGGTATTTGTATAGTATGGGGATCGTTGGTACTAAGATATATGCGAGATTGAGGTAAAAAAGACGGAGGC[G/A]
AGGATTTTTATACAAGTTCGGACCCCTTATCTGACAGGTAATAGCCCTACATCCTGTTGGCCGAAGCCGGTCGTTGCTCTTATTCACCATAATCACACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 2.50% 0.30% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.70% 7.50% 0.86% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 1.00% 1.43% 0.00% NA
Tropical Japonica  504 86.10% 13.70% 0.20% 0.00% NA
Japonica Intermediate  241 84.60% 14.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207304262 C -> T LOC_Os02g13610.1 upstream_gene_variant ; 798.0bp to feature; MODIFIER silent_mutation Average:59.799; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207304262 C -> T LOC_Os02g13590.1 downstream_gene_variant ; 4235.0bp to feature; MODIFIER silent_mutation Average:59.799; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207304262 C -> T LOC_Os02g13600.1 downstream_gene_variant ; 2589.0bp to feature; MODIFIER silent_mutation Average:59.799; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0207304262 C -> T LOC_Os02g13610-LOC_Os02g13620 intergenic_region ; MODIFIER silent_mutation Average:59.799; most accessible tissue: Minghui63 root, score: 78.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207304262 2.21E-06 2.21E-06 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207304262 NA 1.12E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207304262 NA 7.74E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207304262 NA 9.77E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207304262 NA 6.08E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251