Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207161968:

Variant ID: vg0207161968 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7161968
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAATACAAGATTAATTAAAATTCGAAATAAAAATAAAATAAAATCCAAAATTAAAAAAGAAAAGGAGAGTCCAAGTAGAAATACAATTTAAAAATAGCT[A/G]
AAATTCGGAATTAAAAATAAAGAATATTGAAATAAGTTTCCATATAAGTACCCAATACGAGATTAATCAAAAATGAAATAAAAATAAAATAAAATCTAAA

Reverse complement sequence

TTTAGATTTTATTTTATTTTTATTTCATTTTTGATTAATCTCGTATTGGGTACTTATATGGAAACTTATTTCAATATTCTTTATTTTTAATTCCGAATTT[T/C]
AGCTATTTTTAAATTGTATTTCTACTTGGACTCTCCTTTTCTTTTTTAATTTTGGATTTTATTTTATTTTTATTTCGAATTTTAATTAATCTTGTATTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	19.70%	0.68%	12.63%	NA
All Indica	2759	98.20%	1.00%	0.18%	0.58%	NA
All Japonica	1512	4.00%	57.00%	1.52%	37.50%	NA
Aus	269	96.30%	1.50%	1.12%	1.12%	NA
Indica I	595	98.20%	1.50%	0.34%	0.00%	NA
Indica II	465	98.90%	0.40%	0.00%	0.65%	NA
Indica III	913	98.20%	0.70%	0.33%	0.77%	NA
Indica Intermediate	786	97.80%	1.40%	0.00%	0.76%	NA
Temperate Japonica	767	2.30%	81.60%	0.52%	15.51%	NA
Tropical Japonica	504	5.60%	22.20%	3.17%	69.05%	NA
Japonica Intermediate	241	5.80%	51.50%	1.24%	41.49%	NA
VI/Aromatic	96	80.20%	16.70%	0.00%	3.12%	NA
Intermediate	90	67.80%	22.20%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207161968	A -> G	LOC_Os02g13410.1	upstream_gene_variant ; 4844.0bp to feature; MODIFIER	silent_mutation	Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0207161968	A -> G	LOC_Os02g13420.1	upstream_gene_variant ; 2854.0bp to feature; MODIFIER	silent_mutation	Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0207161968	A -> G	LOC_Os02g13410-LOC_Os02g13420	intergenic_region ; MODIFIER	silent_mutation	Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0207161968	A -> DEL	N	N	silent_mutation	Average:16.887; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207161968	NA	1.35E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	5.77E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	5.10E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	9.01E-09	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	4.25E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	1.71E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	2.07E-15	mr1741	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	5.58E-07	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207161968	NA	7.09E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251