Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206309979:

Variant ID: vg0206309979 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6309979
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACGCCTCAGGAGGGGGAATAACCATCGTTGTCGGTCTGGCCAAGGCTAGACTGGGTTTTCACCCGCCTCTCACCACCTGCGAAACCACGGCTGACGCA[T/C]
CGATGCTCCACCACCACACAAGCTTTGCCGACATGTGGGACCCCTGCACCGGCGTCCCCCGCCAGCTAGCCTTCGCGCACCGAAGGCCGCGTCACACCCA

Reverse complement sequence

TGGGTGTGACGCGGCCTTCGGTGCGCGAAGGCTAGCTGGCGGGGGACGCCGGTGCAGGGGTCCCACATGTCGGCAAAGCTTGTGTGGTGGTGGAGCATCG[A/G]
TGCGTCAGCCGTGGTTTCGCAGGTGGTGAGAGGCGGGTGAAAACCCAGTCTAGCCTTGGCCAGACCGACAACGATGGTTATTCCCCCTCCTGAGGCGTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 4.00% 0.00% 3.87% NA
All Indica  2759 95.50% 1.70% 0.00% 2.72% NA
All Japonica  1512 99.50% 0.30% 0.00% 0.13% NA
Aus  269 30.50% 44.60% 0.00% 24.91% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 92.50% 0.20% 0.00% 7.31% NA
Indica III  913 96.10% 2.00% 0.00% 1.97% NA
Indica Intermediate  786 93.40% 3.70% 0.00% 2.93% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.00% 0.83% NA
VI/Aromatic  96 54.20% 9.40% 0.00% 36.46% NA
Intermediate  90 87.80% 7.80% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206309979 T -> DEL N N silent_mutation Average:78.477; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0206309979 T -> C LOC_Os02g12130.1 upstream_gene_variant ; 1232.0bp to feature; MODIFIER silent_mutation Average:78.477; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N
vg0206309979 T -> C LOC_Os02g12120.1 intron_variant ; MODIFIER silent_mutation Average:78.477; most accessible tissue: Minghui63 panicle, score: 88.595 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206309979 T C 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206309979 NA 3.46E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 7.22E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 1.24E-16 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 4.44E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 2.65E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 5.05E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 2.20E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 3.62E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 1.42E-07 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 3.43E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 4.86E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 2.32E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 4.69E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 4.96E-12 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 8.00E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 4.19E-09 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 3.50E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 7.34E-09 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 6.26E-07 mr1988 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309979 NA 5.20E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251