Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206099857:

Variant ID: vg0206099857 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6099857
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCACGTGGCCCTCCCCCGAGGGGAGTGAGGCCGGAGGTGGGGCGGCGGCCACTCCTTCCCAAAGACTAGTGGGGGGCACTCTAAACATGATACCCCGGG[C/T]
CCATATCACCGACAGTAGCCCCCGGCGTTAGCCCTGACCAAACCCTTTCCCAGGTGGTCAGGGTTGACGCCAATCTTCTAGTCAGTTGACATGTGGGCCC

Reverse complement sequence

GGGCCCACATGTCAACTGACTAGAAGATTGGCGTCAACCCTGACCACCTGGGAAAGGGTTTGGTCAGGGCTAACGCCGGGGGCTACTGTCGGTGATATGG[G/A]
CCCGGGGTATCATGTTTAGAGTGCCCCCCACTAGTCTTTGGGAAGGAGTGGCCGCCGCCCCACCTCCGGCCTCACTCCCCTCGGGGGAGGGCCACGTGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.70%	32.00%	1.23%	28.04%	NA
All Indica	2759	51.70%	2.30%	1.92%	44.07%	NA
All Japonica	1512	3.00%	91.70%	0.13%	5.16%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	56.60%	0.80%	1.51%	41.01%	NA
Indica II	465	62.80%	0.60%	1.29%	35.27%	NA
Indica III	913	42.60%	3.50%	2.08%	51.81%	NA
Indica Intermediate	786	51.90%	3.10%	2.42%	42.62%	NA
Temperate Japonica	767	1.80%	88.80%	0.13%	9.26%	NA
Tropical Japonica	504	4.40%	95.00%	0.00%	0.60%	NA
Japonica Intermediate	241	4.10%	93.80%	0.41%	1.66%	NA
VI/Aromatic	96	55.20%	25.00%	2.08%	17.71%	NA
Intermediate	90	43.30%	41.10%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206099857	C -> T	LOC_Os02g11790.1	upstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0206099857	C -> T	LOC_Os02g11800.1	downstream_gene_variant ; 4806.0bp to feature; MODIFIER	silent_mutation	Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0206099857	C -> T	LOC_Os02g11790-LOC_Os02g11800	intergenic_region ; MODIFIER	silent_mutation	Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N
vg0206099857	C -> DEL	N	N	silent_mutation	Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206099857	NA	3.08E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	6.03E-15	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	6.52E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	1.22E-38	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	2.03E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	2.03E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	3.27E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	1.52E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	1.21E-06	2.52E-06	mr1768_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857	NA	4.11E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251