Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206023372:

Variant ID: vg0206023372 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6023372
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGAGGGTATAAGATTGATATTTTGGTCACCGAGTTATACTACTATTATGATTTACAAATTTATTGTTTTCATTTTACCAGTAACTTATTATCGGGAAT[T/C]
TGTTTTCTGTTTTTTTCATATCTTGTGTCGTTTAACTTTTATTAAAAATATATGGTTGTGGATGACGGATGGTGCAGGAGTTCCTTTGTTGGGGGTTCTG

Reverse complement sequence

CAGAACCCCCAACAAAGGAACTCCTGCACCATCCGTCATCCACAACCATATATTTTTAATAAAAGTTAAACGACACAAGATATGAAAAAAACAGAAAACA[A/G]
ATTCCCGATAATAAGTTACTGGTAAAATGAAAACAATAAATTTGTAAATCATAATAGTAGTATAACTCGGTGACCAAAATATCAATCTTATACCCTCCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.60%	49.40%	0.02%	0.00%	NA
All Indica	2759	18.70%	81.30%	0.00%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	34.60%	65.40%	0.00%	0.00%	NA
Indica II	465	12.50%	87.50%	0.00%	0.00%	NA
Indica III	913	10.00%	90.00%	0.00%	0.00%	NA
Indica Intermediate	786	20.40%	79.60%	0.00%	0.00%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206023372	T -> C	LOC_Os02g11700.1	upstream_gene_variant ; 4517.0bp to feature; MODIFIER	silent_mutation	Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0206023372	T -> C	LOC_Os02g11710.1	upstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0206023372	T -> C	LOC_Os02g11705.1	downstream_gene_variant ; 2112.0bp to feature; MODIFIER	silent_mutation	Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N
vg0206023372	T -> C	LOC_Os02g11705-LOC_Os02g11710	intergenic_region ; MODIFIER	silent_mutation	Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206023372	NA	1.90E-14	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	NA	1.03E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	NA	3.24E-13	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	8.00E-06	1.40E-12	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	1.37E-06	1.37E-06	mr1714	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	NA	1.33E-11	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	NA	1.96E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372	1.76E-06	3.86E-06	mr1714_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251