RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0205960798:

Variant ID: vg0205960798 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5960798
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGTTCAGATCATTGCTTTTGTACACGGATCATCAGTATATTGTGGAATCGATTAATTAGGATGATGTTGCTCTTTCAACCCCAACTTGTGGAGATTAT[G/A]
GGTACCCCATACCTACACGGCATGGTTATCCGACTAGTTATAGGGGATAACTTATATCTATGGAATATGTAACAGATCATGACTTGGGTATTACGTTTCC

Reverse complement sequence

GGAAACGTAATACCCAAGTCATGATCTGTTACATATTCCATAGATATAAGTTATCCCCTATAACTAGTCGGATAACCATGCCGTGTAGGTATGGGGTACC[C/T]
ATAATCTCCACAAGTTGGGGTTGAAAGAGCAACATCATCCTAATTAATCGATTCCACAATATACTGATGATCCGTGTACAAAAGCAATGATCTGAACCTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	6.40%	0.02%	0.00%	NA
All Indica	2759	96.80%	3.20%	0.00%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	27.50%	72.50%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	96.60%	3.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.30%	6.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205960798	G -> A	LOC_Os02g11110.1	upstream_gene_variant ; 3496.0bp to feature; MODIFIER	silent_mutation	Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0205960798	G -> A	LOC_Os02g11120.1	upstream_gene_variant ; 1456.0bp to feature; MODIFIER	silent_mutation	Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0205960798	G -> A	LOC_Os02g11110.2	upstream_gene_variant ; 3496.0bp to feature; MODIFIER	silent_mutation	Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N
vg0205960798	G -> A	LOC_Os02g11110-LOC_Os02g11120	intergenic_region ; MODIFIER	silent_mutation	Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205960798	NA	3.51E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	9.27E-09	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	2.13E-06	8.10E-10	mr1058	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	7.43E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	8.97E-06	mr1196	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	7.46E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	1.02E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	5.51E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	1.22E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205960798	NA	1.03E-09	mr1230	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 66 entries

Previous1 2 3 4 5 6 7Next

Search for Variation information by Variation ID:

Detailed information for vg0205960798:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact