Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205570340:

Variant ID: vg0205570340 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5570340
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGCTAAAACTGACTTGGAGTGTTCATTATTCATTTTTTATTTTACTAAAAAAAATGCCCGTGCGTTGCAACAGGTGAAGTCTATTTTAATCTTATTATT[G/T]
TTATATGATTTAGTTTAGATAAAATTCACTCTGGGAGTTCGCTTGGATATATATTTTTTTAGAAAATCATGAACTGCAGTTAGGAGTCCGATCATTCCAA

Reverse complement sequence

TTGGAATGATCGGACTCCTAACTGCAGTTCATGATTTTCTAAAAAAATATATATCCAAGCGAACTCCCAGAGTGAATTTTATCTAAACTAAATCATATAA[C/A]
AATAATAAGATTAAAATAGACTTCACCTGTTGCAACGCACGGGCATTTTTTTTAGTAAAATAAAAAATGAATAATGAACACTCCAAGTCAGTTTTAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	4.70%	4.63%	7.00%	NA
All Indica	2759	87.90%	0.00%	0.22%	11.85%	NA
All Japonica	1512	71.50%	14.50%	13.89%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	0.00%	0.17%	1.68%	NA
Indica II	465	86.50%	0.00%	0.22%	13.33%	NA
Indica III	913	82.40%	0.00%	0.11%	17.52%	NA
Indica Intermediate	786	87.40%	0.10%	0.38%	12.09%	NA
Temperate Japonica	767	56.80%	22.00%	21.12%	0.00%	NA
Tropical Japonica	504	91.50%	4.80%	3.57%	0.20%	NA
Japonica Intermediate	241	76.30%	10.80%	12.45%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205570340	G -> T	LOC_Os02g10590.1	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0205570340	G -> T	LOC_Os02g10600.1	upstream_gene_variant ; 2842.0bp to feature; MODIFIER	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0205570340	G -> T	LOC_Os02g10590.2	upstream_gene_variant ; 539.0bp to feature; MODIFIER	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0205570340	G -> T	LOC_Os02g10580.1	downstream_gene_variant ; 2720.0bp to feature; MODIFIER	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0205570340	G -> T	LOC_Os02g10590-LOC_Os02g10600	intergenic_region ; MODIFIER	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0205570340	G -> DEL	N	N	silent_mutation	Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205570340	3.97E-07	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205570340	NA	7.70E-06	mr1358	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205570340	9.90E-06	3.64E-07	mr1358	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251