Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205559811:

Variant ID: vg0205559811 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5559811
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

AGATCCCGGGTGAAATAACCGGGAGTAAAAATCCATTTTTAGTCACGGTTGGTGTCATCAACCGGGACTAAAAATAGAACATTTTTAGTCCCGGTTGGTA[A/T]
CAAGATAGAGCTAGGCTAGCTAGATCCGGTTGCTCTATTATTCTATTCTTTTCTTCATTGTTTTTAATATATTGATTTCACTCCATCCCCATCCCAAAAT

Reverse complement sequence

ATTTTGGGATGGGGATGGAGTGAAATCAATATATTAAAAACAATGAAGAAAAGAATAGAATAATAGAGCAACCGGATCTAGCTAGCCTAGCTCTATCTTG[T/A]
TACCAACCGGGACTAAAAATGTTCTATTTTTAGTCCCGGTTGATGACACCAACCGTGACTAAAAATGGATTTTTACTCCCGGTTATTTCACCCGGGATCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	45.10%	0.19%	0.00%	NA
All Indica	2759	88.90%	10.90%	0.18%	0.00%	NA
All Japonica	1512	1.30%	98.60%	0.07%	0.00%	NA
Aus	269	27.10%	72.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	70.50%	29.50%	0.00%	0.00%	NA
Indica III	913	93.60%	6.20%	0.11%	0.00%	NA
Indica Intermediate	786	86.10%	13.50%	0.38%	0.00%	NA
Temperate Japonica	767	1.70%	98.30%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	34.40%	62.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205559811	A -> T	LOC_Os02g10560.1	upstream_gene_variant ; 463.0bp to feature; MODIFIER	silent_mutation	Average:38.79; most accessible tissue: Callus, score: 53.393	N	N	N	N
vg0205559811	A -> T	LOC_Os02g10550.1	downstream_gene_variant ; 3632.0bp to feature; MODIFIER	silent_mutation	Average:38.79; most accessible tissue: Callus, score: 53.393	N	N	N	N
vg0205559811	A -> T	LOC_Os02g10570.1	downstream_gene_variant ; 1487.0bp to feature; MODIFIER	silent_mutation	Average:38.79; most accessible tissue: Callus, score: 53.393	N	N	N	N
vg0205559811	A -> T	LOC_Os02g10550-LOC_Os02g10560	intergenic_region ; MODIFIER	silent_mutation	Average:38.79; most accessible tissue: Callus, score: 53.393	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205559811	NA	3.19E-15	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	3.39E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	2.33E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	1.43E-15	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	1.79E-06	5.69E-10	mr1170	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	3.83E-15	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	4.26E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	9.07E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	1.57E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	5.27E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205559811	NA	9.50E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251