Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205481873:

Variant ID: vg0205481873 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5481873
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GATATCTAAGAATAATAGGTTATCTAGTGCTAGTCATGCATGGTTACAATGGTTTACATATATTATGTTCTTACATTCATCAATTCACAGGCACATTTTA[A/C]
GTGAACTTTTTTTTCTACCATGTTATCATCATCACACGGTTCTTAATAAAAAGGCAACGATAAGGCATAATGCATAGTGAATTCCAAATTGAGCGAAGGC

Reverse complement sequence

GCCTTCGCTCAATTTGGAATTCACTATGCATTATGCCTTATCGTTGCCTTTTTATTAAGAACCGTGTGATGATGATAACATGGTAGAAAAAAAAGTTCAC[T/G]
TAAAATGTGCCTGTGAATTGATGAATGTAAGAACATAATATATGTAAACCATTGTAACCATGCATGACTAGCACTAGATAACCTATTATTCTTAGATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 30.90% 0.02% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 7.10% 92.80% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 4.40% 95.40% 0.13% 0.00% NA
Tropical Japonica  504 12.30% 87.70% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205481873 A -> C LOC_Os02g10420.1 upstream_gene_variant ; 3707.0bp to feature; MODIFIER silent_mutation Average:44.545; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0205481873 A -> C LOC_Os02g10430.1 upstream_gene_variant ; 992.0bp to feature; MODIFIER silent_mutation Average:44.545; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0205481873 A -> C LOC_Os02g10440.1 upstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:44.545; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0205481873 A -> C LOC_Os02g10430.2 upstream_gene_variant ; 992.0bp to feature; MODIFIER silent_mutation Average:44.545; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0205481873 A -> C LOC_Os02g10430-LOC_Os02g10440 intergenic_region ; MODIFIER silent_mutation Average:44.545; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205481873 NA 9.01E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 4.04E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.17E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 4.78E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 4.31E-43 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 3.53E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.73E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.04E-06 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 4.22E-52 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.03E-34 mr1780 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 5.51E-36 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 5.67E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 9.00E-31 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 2.33E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 6.51E-21 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 2.11E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 4.10E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 6.10E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.22E-57 mr1480_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 8.59E-27 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 8.08E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 1.58E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 2.17E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 2.32E-59 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 8.13E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 5.82E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205481873 NA 7.07E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251