Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205284069:

Variant ID: vg0205284069 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5284069
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATGGTTGAAATAAGAAAAAACTAATGCGTATGAAGCAAAAAAAAAACTTTTGTAATACGTAATCTTTTTTAGTATTTATAAATTTTTGCATTAAAA[A/G]
CAAGATTAAATTAATTTCAACTTTGTATATCACAAAACTATATATTTAAAAATTTGTATCACAAAAATTATGGATTTAACATAATTTTCATTTACAAAAT

Reverse complement sequence

ATTTTGTAAATGAAAATTATGTTAAATCCATAATTTTTGTGATACAAATTTTTAAATATATAGTTTTGTGATATACAAAGTTGAAATTAATTTAATCTTG[T/C]
TTTTAATGCAAAAATTTATAAATACTAAAAAAGATTACGTATTACAAAAGTTTTTTTTTTGCTTCATACGCATTAGTTTTTTCTTATTTCAACCATTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.10% 0.89% 0.00% NA
All Indica  2759 88.30% 10.40% 1.34% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 68.40% 26.90% 4.71% 0.00% NA
Indica II  465 94.40% 4.50% 1.08% 0.00% NA
Indica III  913 95.70% 4.20% 0.11% 0.00% NA
Indica Intermediate  786 91.00% 8.70% 0.38% 0.00% NA
Temperate Japonica  767 99.50% 0.10% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205284069 A -> G LOC_Os02g10120.1 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:40.214; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N
vg0205284069 A -> G LOC_Os02g10120-LOC_Os02g10130 intergenic_region ; MODIFIER silent_mutation Average:40.214; most accessible tissue: Minghui63 flag leaf, score: 82.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205284069 NA 5.50E-07 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 7.86E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 2.17E-06 5.00E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 9.78E-07 1.73E-08 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 8.63E-06 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 5.25E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 6.18E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 1.70E-06 mr1767 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 2.70E-07 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 2.37E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 7.43E-10 NA mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 1.97E-10 1.52E-13 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 2.79E-09 NA mr1921 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 2.54E-10 6.07E-13 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 1.63E-07 6.02E-08 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 4.35E-07 9.59E-08 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 3.02E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 8.42E-06 7.12E-09 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 2.00E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 6.09E-07 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 1.67E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 9.41E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205284069 NA 2.19E-06 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251