Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204366436:

Variant ID: vg0204366436 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4366436
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTAGAAGTAGAGAATAGAGTCCATATAGAAATACAATTTACAGAAAATTCGGAATTAAAATAAATAAATATTAAAAGACGAGTCTAGATTCCATAT[A/G]
GGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACACGTATATAAAATACAATATGAATATGACACATTAGTAGTT

Reverse complement sequence

AACTACTAATGTGTCATATTCATATTGTATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCC[T/C]
ATATGGAATCTAGACTCGTCTTTTAATATTTATTTATTTTAATTCCGAATTTTCTGTAAATTGTATTTCTATATGGACTCTATTCTCTACTTCTAATATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.10%	25.60%	11.79%	18.54%	NA
All Indica	2759	14.40%	35.20%	19.25%	31.17%	NA
All Japonica	1512	97.90%	1.70%	0.33%	0.13%	NA
Aus	269	27.50%	65.80%	5.20%	1.49%	NA
Indica I	595	6.40%	23.70%	16.13%	53.78%	NA
Indica II	465	4.10%	38.30%	24.73%	32.90%	NA
Indica III	913	21.00%	43.50%	19.39%	16.10%	NA
Indica Intermediate	786	18.70%	32.60%	18.19%	30.53%	NA
Temperate Japonica	767	99.10%	0.50%	0.26%	0.13%	NA
Tropical Japonica	504	98.20%	1.60%	0.20%	0.00%	NA
Japonica Intermediate	241	93.40%	5.40%	0.83%	0.41%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	62.20%	18.90%	7.78%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204366436	A -> G	LOC_Os02g08230.1	upstream_gene_variant ; 4048.0bp to feature; MODIFIER	silent_mutation	Average:31.248; most accessible tissue: Callus, score: 74.099	N	N	N	N
vg0204366436	A -> G	LOC_Os02g08230.2	upstream_gene_variant ; 4091.0bp to feature; MODIFIER	silent_mutation	Average:31.248; most accessible tissue: Callus, score: 74.099	N	N	N	N
vg0204366436	A -> G	LOC_Os02g08230-LOC_Os02g08240	intergenic_region ; MODIFIER	silent_mutation	Average:31.248; most accessible tissue: Callus, score: 74.099	N	N	N	N
vg0204366436	A -> DEL	N	N	silent_mutation	Average:31.248; most accessible tissue: Callus, score: 74.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204366436	6.26E-06	6.26E-06	mr1845	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251