Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203685324:

Variant ID: vg0203685324 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3685324
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

GCGAATCTTTTGAGCCTAATTAGTTCATGATTAGCCATGAGTGCTACAGTAACACACATACGTTAATGACGGATTAACTAGGCTCAAAAGATTTGTCTCG[T/C]
GGTTTCCAGGCGAGTTATGAAATTAGTTTTTTTATTCGTGTCCGAAAACCCCTTCCGACATCCGGTCAAACGTTCGATGTGACATCCAAAATTTTTTTTT

Reverse complement sequence

AAAAAAAAATTTTGGATGTCACATCGAACGTTTGACCGGATGTCGGAAGGGGTTTTCGGACACGAATAAAAAAACTAATTTCATAACTCGCCTGGAAACC[A/G]
CGAGACAAATCTTTTGAGCCTAGTTAATCCGTCATTAACGTATGTGTGTTACTGTAGCACTCATGGCTAATCATGAACTAATTAGGCTCAAAAGATTCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.20%	12.70%	0.13%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.07%	0.00%	NA
All Japonica	1512	62.70%	37.20%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	36.50%	63.40%	0.13%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	73.00%	26.60%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203685324	T -> C	LOC_Os02g07170.1	upstream_gene_variant ; 1198.0bp to feature; MODIFIER	silent_mutation	Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358	N	N	N	N
vg0203685324	T -> C	LOC_Os02g07180.1	upstream_gene_variant ; 2595.0bp to feature; MODIFIER	silent_mutation	Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358	N	N	N	N
vg0203685324	T -> C	LOC_Os02g07170-LOC_Os02g07180	intergenic_region ; MODIFIER	silent_mutation	Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203685324	NA	8.53E-17	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203685324	NA	1.77E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203685324	NA	1.23E-14	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203685324	NA	5.84E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	1.54E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	4.79E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	4.40E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	1.76E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	3.48E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	5.93E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	8.43E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	9.76E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	4.59E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	3.63E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	4.86E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	9.02E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	NA	5.48E-06	mr1892_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203685324	3.20E-06	3.18E-06	mr1919_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251