Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203671161:

Variant ID: vg0203671161 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3671161
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTTTCTTTTCTTTTTTTTAAAAAAAAAATGGTTCGGAGATTTGAAAATATAGTGTGAGTGTGAGTTATAATCAACAAAAGTATTTCTAGTGGTAGA[C/T]
GGCGTACTCATCAACAGCAACATGTCCGTGGTGACTTCGTTAATCTCAAAATGTGTCGGTCCGGTTTCCCGGGTGCTCGTTGTGCATGGGTACGATCATA

Reverse complement sequence

TATGATCGTACCCATGCACAACGAGCACCCGGGAAACCGGACCGACACATTTTGAGATTAACGAAGTCACCACGGACATGTTGCTGTTGATGAGTACGCC[G/A]
TCTACCACTAGAAATACTTTTGTTGATTATAACTCACACTCACACTATATTTTCAAATCTCCGAACCATTTTTTTTTTAAAAAAAAGAAAAGAAAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.90%	2.90%	0.17%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.07%	0.00%	NA
All Japonica	1512	91.30%	8.30%	0.40%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	76.00%	22.80%	1.19%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203671161	C -> T	LOC_Os02g07120.1	upstream_gene_variant ; 1838.0bp to feature; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0203671161	C -> T	LOC_Os02g07130.1	upstream_gene_variant ; 456.0bp to feature; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0203671161	C -> T	LOC_Os02g07150.1	upstream_gene_variant ; 3512.0bp to feature; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0203671161	C -> T	LOC_Os02g07150.3	upstream_gene_variant ; 3512.0bp to feature; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0203671161	C -> T	LOC_Os02g07140.1	downstream_gene_variant ; 2154.0bp to feature; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N
vg0203671161	C -> T	LOC_Os02g07130-LOC_Os02g07140	intergenic_region ; MODIFIER	silent_mutation	Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203671161	1.57E-06	6.28E-09	mr1125	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	NA	8.41E-09	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	4.00E-06	6.78E-11	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	6.87E-09	1.38E-11	mr1448	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	NA	5.99E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	5.08E-06	1.68E-10	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	NA	2.43E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161	5.17E-06	7.09E-15	mr1188_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251