Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202781823:

Variant ID: vg0202781823 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2781823
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGAGGCGAGCGCGGCGGTGCGAGTCGCGTCCTTGACGGGGAGGCGGGCGACGCGGAGGTCGTCGGGGAGAGTGCTAACGCTGTCCTCGCCGTCATAGC[C/T]
CTCGGCGGCGGAAAGCGTGGCGCCGTTGCCGGAGGCGGGATGGCCGAGGAACCACCGGAGGCGGCCTCTGACTTGGAGGCGGCCTTGGACGTCGCGAGGA

Reverse complement sequence

TCCTCGCGACGTCCAAGGCCGCCTCCAAGTCAGAGGCCGCCTCCGGTGGTTCCTCGGCCATCCCGCCTCCGGCAACGGCGCCACGCTTTCCGCCGCCGAG[G/A]
GCTATGACGGCGAGGACAGCGTTAGCACTCTCCCCGACGACCTCCGCGTCGCCCGCCTCCCCGTCAAGGACGCGACTCGCACCGCCGCGCTCGCCTCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 25.90% 0.13% 0.00% NA
All Indica  2759 56.00% 43.70% 0.22% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 63.00% 36.60% 0.34% 0.00% NA
Indica II  465 37.40% 62.20% 0.43% 0.00% NA
Indica III  913 63.90% 36.00% 0.11% 0.00% NA
Indica Intermediate  786 52.70% 47.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202781823 C -> T LOC_Os02g05686.1 upstream_gene_variant ; 4936.0bp to feature; MODIFIER silent_mutation Average:91.907; most accessible tissue: Zhenshan97 flag leaf, score: 98.462 N N N N
vg0202781823 C -> T LOC_Os02g05680.1 downstream_gene_variant ; 2437.0bp to feature; MODIFIER silent_mutation Average:91.907; most accessible tissue: Zhenshan97 flag leaf, score: 98.462 N N N N
vg0202781823 C -> T LOC_Os02g05680.2 downstream_gene_variant ; 2437.0bp to feature; MODIFIER silent_mutation Average:91.907; most accessible tissue: Zhenshan97 flag leaf, score: 98.462 N N N N
vg0202781823 C -> T LOC_Os02g05680-LOC_Os02g05686 intergenic_region ; MODIFIER silent_mutation Average:91.907; most accessible tissue: Zhenshan97 flag leaf, score: 98.462 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0202781823 C T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202781823 NA 2.15E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202781823 NA 1.88E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202781823 NA 8.79E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202781823 NA 2.56E-09 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202781823 2.97E-06 2.97E-06 mr1954 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202781823 NA 1.64E-08 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251