Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202735231:

Variant ID: vg0202735231 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2735231
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, G: 0.30, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATGGACAGAATGATAGGTATCTTTTATTTAGTCTTTTATTAAGTCCGGACACAAGTACACAACTGATCTCATATTTGCAAGCAAACACTAGGAATT[C/G]
AAACAGCCTACAGTATATTACCATAAGAGCTATTTATGCAATGAGATAGTCTGTCTGGATCACTGCTGCTAAAAAAGATGAAGGCTCCATGAAGAATTGT

Reverse complement sequence

ACAATTCTTCATGGAGCCTTCATCTTTTTTAGCAGCAGTGATCCAGACAGACTATCTCATTGCATAAATAGCTCTTATGGTAATATACTGTAGGCTGTTT[G/C]
AATTCCTAGTGTTTGCTTGCAAATATGAGATCAGTTGTGTACTTGTGTCCGGACTTAATAAAAGACTAAATAAAAGATACCTATCATTCTGTCCATTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.40% 0.13% 0.00% NA
All Indica  2759 96.60% 3.30% 0.14% 0.00% NA
All Japonica  1512 87.10% 12.90% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 94.70% 4.90% 0.33% 0.00% NA
Indica Intermediate  786 94.90% 5.00% 0.13% 0.00% NA
Temperate Japonica  767 80.60% 19.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202735231 C -> G LOC_Os02g05610.1 downstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:80.994; most accessible tissue: Callus, score: 94.87 N N N N
vg0202735231 C -> G LOC_Os02g05620.1 downstream_gene_variant ; 655.0bp to feature; MODIFIER silent_mutation Average:80.994; most accessible tissue: Callus, score: 94.87 N N N N
vg0202735231 C -> G LOC_Os02g05610-LOC_Os02g05620 intergenic_region ; MODIFIER silent_mutation Average:80.994; most accessible tissue: Callus, score: 94.87 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0202735231 C G -0.02 -0.02 -0.02 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202735231 4.24E-06 NA mr1166 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.02E-11 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.81E-08 1.56E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.78E-11 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 9.12E-08 2.25E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 6.50E-07 NA mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 3.31E-10 3.31E-10 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 8.19E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 9.81E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.73E-06 5.95E-12 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 1.79E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 7.63E-10 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.84E-06 2.88E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.65E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 2.27E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 1.67E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.96E-07 NA mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 5.76E-06 7.24E-07 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 7.77E-06 7.76E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 1.24E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 3.03E-06 3.03E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.70E-10 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.19E-08 4.88E-12 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 8.75E-06 2.74E-08 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.68E-06 4.67E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.85E-06 2.96E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 1.06E-08 7.30E-16 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 6.13E-07 4.76E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 8.67E-06 8.67E-06 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 NA 1.02E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 2.42E-06 NA mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202735231 6.95E-07 9.14E-09 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251