Variant ID: vg0200923972 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 923972 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 191. )
CATTTGAGGCCAGTTTGGCAACTGAAAAACTGTATAGAAAGTTATTCTTGTCCTTGATGGTATTTTGAATGGAGGAAATATATACGTCTGTTTGATTAAT[T/C]
TTTTCATGAACTTTCTCTTGTCATGCTTGATGTGTACCTTGTCCCTGAATCTATGTGAGCAGTCAAGTCTTCAACTTTTCTGTCTAAACCATATGAAATC
GATTTCATATGGTTTAGACAGAAAAGTTGAAGACTTGACTGCTCACATAGATTCAGGGACAAGGTACACATCAAGCATGACAAGAGAAAGTTCATGAAAA[A/G]
ATTAATCAAACAGACGTATATATTTCCTCCATTCAAAATACCATCAAGGACAAGAATAACTTTCTATACAGTTTTTCAGTTGCCAAACTGGCCTCAAATG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.90% | 3.90% | 1.14% | 0.00% | NA |
All Indica | 2759 | 99.40% | 0.40% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 89.40% | 7.90% | 2.65% | 0.00% | NA |
Aus | 269 | 78.80% | 19.00% | 2.23% | 0.00% | NA |
Indica I | 595 | 99.00% | 0.70% | 0.34% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.70% | 0.90% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 94.80% | 1.80% | 3.39% | 0.00% | NA |
Tropical Japonica | 504 | 88.50% | 10.90% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 74.30% | 21.20% | 4.56% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0200923972 | T -> C | LOC_Os02g02550.1 | upstream_gene_variant ; 482.0bp to feature; MODIFIER | silent_mutation | Average:68.754; most accessible tissue: Callus, score: 88.062 | N | N | N | N |
vg0200923972 | T -> C | LOC_Os02g02540.1 | downstream_gene_variant ; 2.0bp to feature; MODIFIER | silent_mutation | Average:68.754; most accessible tissue: Callus, score: 88.062 | N | N | N | N |
vg0200923972 | T -> C | LOC_Os02g02560.1 | downstream_gene_variant ; 2059.0bp to feature; MODIFIER | silent_mutation | Average:68.754; most accessible tissue: Callus, score: 88.062 | N | N | N | N |
vg0200923972 | T -> C | LOC_Os02g02540-LOC_Os02g02550 | intergenic_region ; MODIFIER | silent_mutation | Average:68.754; most accessible tissue: Callus, score: 88.062 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0200923972 | NA | 1.78E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | NA | 2.56E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | 5.66E-06 | 2.72E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | NA | 5.93E-08 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | NA | 3.08E-07 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | NA | 4.34E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | 3.83E-06 | 6.99E-09 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | NA | 1.41E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | 2.17E-07 | 1.34E-10 | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0200923972 | 9.85E-06 | 3.92E-08 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/