RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0200474832:

Variant ID: vg0200474832 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 474832
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCTATTGAAACCTATGGTGCTGAAGTTAATCTTTGCCAATCAGTACTATCTATCTATCTATTATATAATATATAATTAAATGAATAGAAAAAAGGAGC[C/A]
TCCACGTTCGCTCTCATGGCCTAGAAATTCTCACATTAATCGGAGAAAAAGAAGAAAAAGAAAAAGCAGAGTCCATATAGAAATACAATTTAAAAATAGA

Reverse complement sequence

TCTATTTTTAAATTGTATTTCTATATGGACTCTGCTTTTTCTTTTTCTTCTTTTTCTCCGATTAATGTGAGAATTTCTAGGCCATGAGAGCGAACGTGGA[G/T]
GCTCCTTTTTTCTATTCATTTAATTATATATTATATAATAGATAGATAGATAGTACTGATTGGCAAAGATTAACTTCAGCACCATAGGTTTCAATAGAGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.80%	4.10%	0.13%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	52.80%	45.00%	2.23%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200474832	C -> A	LOC_Os02g01850.1	upstream_gene_variant ; 3157.0bp to feature; MODIFIER	silent_mutation	Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N
vg0200474832	C -> A	LOC_Os02g01860.1	downstream_gene_variant ; 2633.0bp to feature; MODIFIER	silent_mutation	Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N
vg0200474832	C -> A	LOC_Os02g01850-LOC_Os02g01860	intergenic_region ; MODIFIER	silent_mutation	Average:36.145; most accessible tissue: Zhenshan97 root, score: 88.474	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200474832	NA	2.48E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	2.73E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	2.41E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	4.79E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	1.50E-07	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	8.33E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	3.34E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	8.05E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	3.89E-08	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200474832	NA	5.83E-07	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 52 entries

Previous1 2 3 4 5 6Next

Search for Variation information by Variation ID:

Detailed information for vg0200474832:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact