Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0200388906:

Variant ID: vg0200388906 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 388906
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, G: 0.39, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGATAGAGAGATAAAAGAACAGGACAAGAAATTAAGAGAGAATAAGGGACCCTTTCAATTGGGAAAATGGAGGGGGGGTAAGGAAAACACGGGAATTT[T/G]
ACAAAAATGTAAATATAAAATAGAGAATTGTAAAATAAAGAAAAAACATAGTAATAATATTTTTATTGGACCATAAAAAAACAAGATAATTTGAGGAGAG

Reverse complement sequence

CTCTCCTCAAATTATCTTGTTTTTTTATGGTCCAATAAAAATATTATTACTATGTTTTTTCTTTATTTTACAATTCTCTATTTTATATTTACATTTTTGT[A/C]
AAATTCCCGTGTTTTCCTTACCCCCCCTCCATTTTCCCAATTGAAAGGGTCCCTTATTCTCTCTTAATTTCTTGTCCTGTTCTTTTATCTCTCTATCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.40%	0.04%	0.00%	NA
All Indica	2759	76.90%	23.00%	0.04%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	86.20%	13.40%	0.37%	0.00%	NA
Indica I	595	74.80%	25.20%	0.00%	0.00%	NA
Indica II	465	83.90%	16.10%	0.00%	0.00%	NA
Indica III	913	76.80%	23.10%	0.11%	0.00%	NA
Indica Intermediate	786	74.70%	25.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0200388906	T -> G	LOC_Os02g01700.1	upstream_gene_variant ; 2042.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0200388906	T -> G	LOC_Os02g01710.1	upstream_gene_variant ; 2913.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0200388906	T -> G	LOC_Os02g01710.4	upstream_gene_variant ; 2913.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0200388906	T -> G	LOC_Os02g01710.2	upstream_gene_variant ; 2913.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0200388906	T -> G	LOC_Os02g01710.3	upstream_gene_variant ; 2913.0bp to feature; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0200388906	T -> G	LOC_Os02g01700-LOC_Os02g01710	intergenic_region ; MODIFIER	silent_mutation	Average:53.743; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0200388906	NA	3.63E-06	mr1084	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200388906	NA	8.19E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200388906	NA	6.65E-06	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0200388906	4.72E-06	NA	mr1417	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251