Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143095495:

Variant ID: vg0143095495 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 43095495
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTGAGTACTTGATGCCGCTGCCGCCACCTAGCCTCAATGGCTTGCGGGAAGGCGTCAACGGCGCGGCGAGCCCCACCGGCTGGCTTCTCCCCCTTACC[T/C]
CCCTCCCTTTCCTCCCTCTCCTACTCAAGCTGGTGTCTCCCCGTCATCGGATCCATCACAACAGCTGCCCATAAACTAGCTTTGCCCTTGCCACCAACAC

Reverse complement sequence

GTGTTGGTGGCAAGGGCAAAGCTAGTTTATGGGCAGCTGTTGTGATGGATCCGATGACGGGGAGACACCAGCTTGAGTAGGAGAGGGAGGAAAGGGAGGG[A/G]
GGTAAGGGGGAGAAGCCAGCCGGTGGGGCTCGCCGCGCCGTTGACGCCTTCCCGCAAGCCATTGAGGCTAGGTGGCGGCAGCGGCATCAAGTACTCAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 42.30% 0.11% 0.00% NA
All Indica  2759 56.30% 43.60% 0.14% 0.00% NA
All Japonica  1512 57.50% 42.40% 0.07% 0.00% NA
Aus  269 53.20% 46.80% 0.00% 0.00% NA
Indica I  595 46.90% 52.80% 0.34% 0.00% NA
Indica II  465 77.40% 22.20% 0.43% 0.00% NA
Indica III  913 49.90% 50.10% 0.00% 0.00% NA
Indica Intermediate  786 58.30% 41.70% 0.00% 0.00% NA
Temperate Japonica  767 21.60% 78.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 1.80% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0143095495 T -> C LOC_Os01g74400.1 upstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:78.493; most accessible tissue: Minghui63 root, score: 93.433 N N N N
vg0143095495 T -> C LOC_Os01g74410.1 upstream_gene_variant ; 906.0bp to feature; MODIFIER silent_mutation Average:78.493; most accessible tissue: Minghui63 root, score: 93.433 N N N N
vg0143095495 T -> C LOC_Os01g74410.2 upstream_gene_variant ; 897.0bp to feature; MODIFIER silent_mutation Average:78.493; most accessible tissue: Minghui63 root, score: 93.433 N N N N
vg0143095495 T -> C LOC_Os01g74400-LOC_Os01g74410 intergenic_region ; MODIFIER silent_mutation Average:78.493; most accessible tissue: Minghui63 root, score: 93.433 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0143095495 T C 0.0 0.01 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0143095495 NA 6.59E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 NA 5.13E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 NA 2.63E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 NA 6.54E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 NA 1.36E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 NA 3.11E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143095495 5.81E-07 6.32E-10 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251