Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142954896:

Variant ID: vg0142954896 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42954896
Reference Allele: T	Alternative Allele: A,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTCATTGTTAAATATACTACTACTCAAGTTTTTGAATAATATTCACAAAA[T/A,G]
TTTTTAAATAAGACAAATGGTCAAACATGTTTAAAAAAGTCAACGGCATCAAATATTTAGGGACGGAGCGAATGATTCAATAGTAATTCTTGCCATCACT

Reverse complement sequence

AGTGATGGCAAGAATTACTATTGAATCATTCGCTCCGTCCCTAAATATTTGATGCCGTTGACTTTTTTAAACATGTTTGACCATTTGTCTTATTTAAAAA[A/T,C]
TTTTGTGAATATTATTCAAAAACTTGAGTAGTAGTATATTTAACAATGAATCAAATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	37.50%	4.08%	0.83%	G: 0.06%
All Indica	2759	78.20%	18.10%	2.25%	1.38%	G: 0.04%
All Japonica	1512	32.70%	59.20%	8.07%	0.07%	NA
Aus	269	11.20%	88.10%	0.74%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	87.70%	9.20%	1.72%	1.29%	NA
Indica III	913	62.70%	30.70%	4.05%	2.63%	NA
Indica Intermediate	786	75.20%	21.50%	2.16%	1.02%	G: 0.13%
Temperate Japonica	767	59.80%	27.80%	12.39%	0.00%	NA
Tropical Japonica	504	1.40%	96.20%	2.18%	0.20%	NA
Japonica Intermediate	241	11.60%	81.70%	6.64%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	40.00%	50.00%	7.78%	0.00%	G: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142954896	T -> G	LOC_Os01g74146.1	downstream_gene_variant ; 2182.0bp to feature; MODIFIER	silent_mutation	Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0142954896	T -> G	LOC_Os01g74152.1	intron_variant ; MODIFIER	silent_mutation	Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0142954896	T -> A	LOC_Os01g74146.1	downstream_gene_variant ; 2182.0bp to feature; MODIFIER	silent_mutation	Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0142954896	T -> A	LOC_Os01g74152.1	intron_variant ; MODIFIER	silent_mutation	Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N
vg0142954896	T -> DEL	N	N	silent_mutation	Average:41.138; most accessible tissue: Zhenshan97 flower, score: 80.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142954896	NA	3.86E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142954896	NA	1.21E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	4.10E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	5.59E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	2.45E-08	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	6.81E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.83E-08	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	9.18E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	5.18E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	8.59E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	3.40E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.32E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	4.22E-21	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	9.52E-09	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	4.31E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.45E-08	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	2.52E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	7.97E-12	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	4.55E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.03E-13	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	7.79E-16	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	6.13E-07	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	3.18E-38	mr1580_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	5.95E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	4.32E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	2.13E-20	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	3.74E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	6.01E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.51E-10	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	1.25E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142954896	NA	7.12E-37	mr1825_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251