Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142903537:

Variant ID: vg0142903537 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42903537
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAATAACTCTCTCATACTATATTTACTCTAGCAACAAACTCGATGCATGCACCATCCCCAATATTTCCTAGCCAATAGCAAATCAAGATATTGCATGTG[G/A]
GTTATAAATACTTGTGTGCATGGATACATGCATCAATGTCTATTTACTCCAATACACAAATAACGAATAGACTTAATAAATGAACACAAATATGTAGATC

Reverse complement sequence

GATCTACATATTTGTGTTCATTTATTAAGTCTATTCGTTATTTGTGTATTGGAGTAAATAGACATTGATGCATGTATCCATGCACACAAGTATTTATAAC[C/T]
CACATGCAATATCTTGATTTGCTATTGGCTAGGAAATATTGGGGATGGTGCATGCATCGAGTTTGTTGCTAGAGTAAATATAGTATGAGAGAGTTATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	10.70%	0.02%	0.00%	NA
All Indica	2759	86.00%	14.00%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	58.00%	42.00%	0.00%	0.00%	NA
Indica I	595	76.10%	23.90%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	83.60%	16.40%	0.00%	0.00%	NA
Indica Intermediate	786	88.50%	11.30%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142903537	G -> A	LOC_Os01g74090.1	upstream_gene_variant ; 1518.0bp to feature; MODIFIER	silent_mutation	Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0142903537	G -> A	LOC_Os01g74100.1	upstream_gene_variant ; 848.0bp to feature; MODIFIER	silent_mutation	Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0142903537	G -> A	LOC_Os01g74080.1	downstream_gene_variant ; 3614.0bp to feature; MODIFIER	silent_mutation	Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0142903537	G -> A	LOC_Os01g74110.1	downstream_gene_variant ; 2029.0bp to feature; MODIFIER	silent_mutation	Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0142903537	G -> A	LOC_Os01g74090-LOC_Os01g74100	intergenic_region ; MODIFIER	silent_mutation	Average:46.952; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142903537	NA	6.92E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	NA	8.96E-08	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	NA	4.34E-06	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	NA	6.72E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	NA	7.62E-06	mr1013_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	3.79E-06	3.79E-06	mr1049_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	NA	1.85E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142903537	4.21E-06	7.74E-09	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251