Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142876260:

Variant ID: vg0142876260 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42876260
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTATCAAATGTTATACTGTTACTGTATATTTTAGGATGTAGTGTTTTATTAGGTCCCATTCGTTTCTAATGAAAAGAATGGATGGAATTTTGAATTCTC[G/A]
TGGCATGTTTTTTAAACTGTTAAACGGTGCGTTTCGTGCGAAAACTTTCTATATAAAAGTTGCCCTAAAATAGCATATTAATTTATTTTTCAAGTTTGTA

Reverse complement sequence

TACAAACTTGAAAAATAAATTAATATGCTATTTTAGGGCAACTTTTATATAGAAAGTTTTCGCACGAAACGCACCGTTTAACAGTTTAAAAAACATGCCA[C/T]
GAGAATTCAAAATTCCATCCATTCTTTTCATTAGAAACGAATGGGACCTAATAAAACACTACATCCTAAAATATACAGTAACAGTATAACATTTGATAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 7.00% 0.04% 1.21% NA
All Indica  2759 86.00% 11.90% 0.07% 2.07% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.30% 24.50% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 83.00% 12.20% 0.00% 4.82% NA
Indica Intermediate  786 89.90% 8.40% 0.13% 1.53% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142876260 G -> A LOC_Os01g74010.1 upstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N
vg0142876260 G -> A LOC_Os01g74020.1 upstream_gene_variant ; 745.0bp to feature; MODIFIER silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N
vg0142876260 G -> A LOC_Os01g74010.2 upstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N
vg0142876260 G -> A LOC_Os01g74030.1 downstream_gene_variant ; 279.0bp to feature; MODIFIER silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N
vg0142876260 G -> A LOC_Os01g74020-LOC_Os01g74030 intergenic_region ; MODIFIER silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N
vg0142876260 G -> DEL N N silent_mutation Average:73.238; most accessible tissue: Callus, score: 92.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0142876260 G A -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142876260 NA 4.60E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 5.52E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 2.67E-06 2.67E-06 mr1249 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 2.79E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 1.89E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 1.86E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 8.39E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 1.64E-11 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 4.87E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 1.33E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 1.71E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 7.09E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 6.11E-07 2.71E-07 mr1985 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 3.66E-07 3.66E-07 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 3.99E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 8.74E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 9.23E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 4.34E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142876260 NA 5.09E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251