Search for Variation information by Variation ID:
Detailed information for vg0142831977:
| Variant ID: vg0142831977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42831977 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CATAGCACGAGCAATGTCCTGGTCGCGGTGCCTGGCGTAGAGGTCTCTAGTGCTCGCAACGTGGGGCTGCTGCTCCAAGGGAGCGAAGGTGACCCTAGTA[T/C]
GGGTGCGTGGCTGGTACCAGCGTAGGTAGGCCTGGTATGCCTCCTCAGTGTGTGGCTCTCCCTCGTGGTCCATGACCTCCTCGGTTGCGAGCAACCAGTA
Reverse complement sequence
TACTGGTTGCTCGCAACCGAGGAGGTCATGGACCACGAGGGAGAGCCACACACTGAGGAGGCATACCAGGCCTACCTACGCTGGTACCAGCCACGCACCC[A/G]
TACTAGGGTCACCTTCGCTCCCTTGGAGCAGCAGCCCCACGTTGCGAGCACTAGAGACCTCTACGCCAGGCACCGCGACCAGGACATTGCTCGTGCTATG
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 18.60% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 73.40% | 26.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 90.90% | 8.70% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.80% | 26.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 91.60% | 8.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.00% | 40.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 78.90% | 21.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 0.80% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 16.70% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142831977 | T -> C | LOC_Os01g73930.1 | missense_variant ; p.His930Arg; MODERATE | nonsynonymous_codon ; H930R | Average:66.618; most accessible tissue: Zhenshan97 flag leaf, score: 82.351 | probably damaging  |
-2.235 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142831977 | NA | 3.77E-07 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142831977 | 1.57E-06 | 6.06E-09 | mr1912 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142831977 | NA | 2.41E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142831977 | NA | 5.75E-06 | mr1388_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142831977 | NA | 3.52E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |