| Variant ID: vg0142709816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42709816 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 99. )
TTCAAAAAATGTAGTTAGTATTTTTTTTATAGAAAAAGTTCAATATGGCTCCCTTAAGATAAGTCAGATTTGATTCATTTCCCTCAACTTCATAAGCCAT[A/G]
ATACCGGATATATCGACCCCTCCAACTATTAATACCAACACAAACGACTTAGATCCAGTTTAAATATTTTGGCTCTTAGAGTCATTTTGTATCCGTTTTA
TAAAACGGATACAAAATGACTCTAAGAGCCAAAATATTTAAACTGGATCTAAGTCGTTTGTGTTGGTATTAATAGTTGGAGGGGTCGATATATCCGGTAT[T/C]
ATGGCTTATGAAGTTGAGGGAAATGAATCAAATCTGACTTATCTTAAGGGAGCCATATTGAACTTTTTCTATAAAAAAAATACTAACTACATTTTTTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 11.70% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 80.00% | 19.60% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 36.80% | 62.60% | 0.65% | 0.00% | NA |
| Indica III | 913 | 93.90% | 5.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 80.00% | 19.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142709816 | A -> G | LOC_Os01g73710.1 | upstream_gene_variant ; 4441.0bp to feature; MODIFIER | silent_mutation | Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0142709816 | A -> G | LOC_Os01g73730.1 | upstream_gene_variant ; 880.0bp to feature; MODIFIER | silent_mutation | Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0142709816 | A -> G | LOC_Os01g73720.1 | downstream_gene_variant ; 1835.0bp to feature; MODIFIER | silent_mutation | Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0142709816 | A -> G | LOC_Os01g73740.1 | downstream_gene_variant ; 3487.0bp to feature; MODIFIER | silent_mutation | Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| vg0142709816 | A -> G | LOC_Os01g73720-LOC_Os01g73730 | intergenic_region ; MODIFIER | silent_mutation | Average:43.484; most accessible tissue: Minghui63 root, score: 72.134 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142709816 | NA | 5.83E-07 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 1.34E-10 | 2.95E-17 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 1.85E-09 | 1.79E-16 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 1.14E-07 | 8.22E-08 | mr1984 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 4.67E-08 | 2.37E-10 | mr1984 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | NA | 8.35E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | NA | 3.99E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | NA | 7.07E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | NA | 6.37E-09 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | NA | 4.08E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 3.35E-09 | 1.05E-14 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142709816 | 2.00E-08 | 5.72E-13 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |