Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142706198:

Variant ID: vg0142706198 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42706198
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, G: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGGTTAACTAATTGTAAATTGTGATGAGATTTCTCATCAGTAAACCAGCCAAGCAAGAACGGATGGTACACAAGTTTTTGTAACAGAGTTTGCTGAT[T/G]
GTAAATTTGGTGGCGTGGCATGCTAGAAAAGCTGGACAAAGTACTCCACATGCAAGCTGAAGTTAGCTAGCAAATATTCAGACGCACGCAATGCGTCATG

Reverse complement sequence

CATGACGCATTGCGTGCGTCTGAATATTTGCTAGCTAACTTCAGCTTGCATGTGGAGTACTTTGTCCAGCTTTTCTAGCATGCCACGCCACCAAATTTAC[A/C]
ATCAGCAAACTCTGTTACAAAAACTTGTGTACCATCCGTTCTTGCTTGGCTGGTTTACTGATGAGAAATCTCATCACAATTTACAATTAGTTAACCACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 37.50% 0.13% 0.00% NA
All Indica  2759 78.00% 21.80% 0.18% 0.00% NA
All Japonica  1512 27.80% 72.20% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 64.00% 36.00% 0.00% 0.00% NA
Indica II  465 78.10% 21.30% 0.65% 0.00% NA
Indica III  913 93.00% 6.90% 0.11% 0.00% NA
Indica Intermediate  786 71.10% 28.80% 0.13% 0.00% NA
Temperate Japonica  767 7.80% 92.20% 0.00% 0.00% NA
Tropical Japonica  504 48.80% 51.20% 0.00% 0.00% NA
Japonica Intermediate  241 47.70% 52.30% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142706198 T -> G LOC_Os01g73700.1 upstream_gene_variant ; 4875.0bp to feature; MODIFIER silent_mutation Average:61.525; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706198 T -> G LOC_Os01g73710.1 upstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:61.525; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706198 T -> G LOC_Os01g73720.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:61.525; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706198 T -> G LOC_Os01g73730.1 upstream_gene_variant ; 4498.0bp to feature; MODIFIER silent_mutation Average:61.525; most accessible tissue: Callus, score: 89.449 N N N N
vg0142706198 T -> G LOC_Os01g73710-LOC_Os01g73720 intergenic_region ; MODIFIER silent_mutation Average:61.525; most accessible tissue: Callus, score: 89.449 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142706198 NA 5.13E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 8.23E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.03E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 2.08E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 4.80E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 2.41E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 3.65E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 9.29E-06 2.50E-11 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.11E-08 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 2.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 6.00E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 2.84E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 8.39E-09 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.88E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.29E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.59E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 7.95E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 4.70E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 2.16E-06 2.16E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 6.23E-08 mr1015_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 3.84E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.06E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 2.01E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 1.58E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 8.29E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 3.78E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 4.07E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 9.37E-08 1.25E-11 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 3.16E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142706198 NA 4.22E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251