| Variant ID: vg0142446761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42446761 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 109. )
TTAGCACAAAATTATAGCTTATAGGGTTTAAATTCTTAGCATTTATGTTATGCCTGAGTTATAAATATCCAAGTTTTTTACTAAATCAATATTTATGAAA[T/A]
TTCACAATTTATAGTTTTATGATAATTTAAAGTATCTGAAATTTACTTTTACTATTATTATTTTTGACGTGTAGTCAGGAGGGCCGGAGTACAAGGTGCC
GGCACCTTGTACTCCGGCCCTCCTGACTACACGTCAAAAATAATAATAGTAAAAGTAAATTTCAGATACTTTAAATTATCATAAAACTATAAATTGTGAA[A/T]
TTTCATAAATATTGATTTAGTAAAAAACTTGGATATTTATAACTCAGGCATAACATAAATGCTAAGAATTTAAACCCTATAAGCTATAATTTTGTGCTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 43.90% | 5.54% | 1.78% | NA |
| All Indica | 2759 | 37.50% | 54.70% | 5.47% | 2.28% | NA |
| All Japonica | 1512 | 74.90% | 16.90% | 6.81% | 1.32% | NA |
| Aus | 269 | 20.40% | 78.80% | 0.37% | 0.37% | NA |
| Indica I | 595 | 11.30% | 73.80% | 11.26% | 3.70% | NA |
| Indica II | 465 | 69.90% | 21.70% | 5.16% | 3.23% | NA |
| Indica III | 913 | 40.10% | 59.40% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 35.20% | 54.50% | 7.12% | 3.18% | NA |
| Temperate Japonica | 767 | 56.80% | 28.30% | 12.39% | 2.48% | NA |
| Tropical Japonica | 504 | 96.00% | 3.20% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.40% | 9.50% | 1.66% | 0.41% | NA |
| VI/Aromatic | 96 | 27.10% | 68.80% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142446761 | T -> A | LOC_Os01g73210.1 | upstream_gene_variant ; 2818.0bp to feature; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> A | LOC_Os01g73234.1 | upstream_gene_variant ; 4362.0bp to feature; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> A | LOC_Os01g73234.2 | upstream_gene_variant ; 4355.0bp to feature; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> A | LOC_Os01g73200.1 | downstream_gene_variant ; 3803.0bp to feature; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> A | LOC_Os01g73230.1 | downstream_gene_variant ; 1143.0bp to feature; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> A | LOC_Os01g73220.1 | intron_variant ; MODIFIER | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| vg0142446761 | T -> DEL | N | N | silent_mutation | Average:76.391; most accessible tissue: Callus, score: 87.947 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142446761 | NA | 4.17E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 1.44E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 2.87E-16 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | 1.90E-08 | 3.62E-11 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | 3.78E-08 | 2.45E-14 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 2.28E-07 | mr1984 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 1.53E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | 5.92E-07 | NA | mr1480_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 1.79E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | 2.19E-06 | NA | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142446761 | NA | 7.17E-09 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |