Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142314165:

Variant ID: vg0142314165 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42314165
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, T: 0.28, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TTTACGAGTTAATCCCATGAAAATTTGAAATATGTATGGATGGTTCACAAGAAACACAGGGATTTGCTGGCTCGAAGTAAAATAAGATAGAAGTAGAGGG[T/A]
AAAATGAATGATGCATTAGATTTGTTAGAAGGAAAAATAATAATGAAATGACAGTTGAGATCATACATGTTCTTTCTATTGAAATACGTTAAACGAAAGC

Reverse complement sequence

GCTTTCGTTTAACGTATTTCAATAGAAAGAACATGTATGATCTCAACTGTCATTTCATTATTATTTTTCCTTCTAACAAATCTAATGCATCATTCATTTT[A/T]
CCCTCTACTTCTATCTTATTTTACTTCGAGCCAGCAAATCCCTGTGTTTCTTGTGAACCATCCATACATATTTCAAATTTTCATGGGATTAACTCGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	27.40%	0.25%	0.00%	NA
All Indica	2759	59.90%	39.70%	0.40%	0.00%	NA
All Japonica	1512	91.70%	8.30%	0.07%	0.00%	NA
Aus	269	82.50%	17.50%	0.00%	0.00%	NA
Indica I	595	69.70%	29.90%	0.34%	0.00%	NA
Indica II	465	24.50%	74.80%	0.65%	0.00%	NA
Indica III	913	67.50%	32.20%	0.33%	0.00%	NA
Indica Intermediate	786	64.50%	35.10%	0.38%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	77.20%	22.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142314165	T -> A	LOC_Os01g72940.1	upstream_gene_variant ; 2988.0bp to feature; MODIFIER	silent_mutation	Average:36.552; most accessible tissue: Callus, score: 48.324	N	N	N	N
vg0142314165	T -> A	LOC_Os01g72960.1	upstream_gene_variant ; 1099.0bp to feature; MODIFIER	silent_mutation	Average:36.552; most accessible tissue: Callus, score: 48.324	N	N	N	N
vg0142314165	T -> A	LOC_Os01g72950.1	downstream_gene_variant ; 588.0bp to feature; MODIFIER	silent_mutation	Average:36.552; most accessible tissue: Callus, score: 48.324	N	N	N	N
vg0142314165	T -> A	LOC_Os01g72950-LOC_Os01g72960	intergenic_region ; MODIFIER	silent_mutation	Average:36.552; most accessible tissue: Callus, score: 48.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142314165	NA	2.42E-06	mr1322	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	4.25E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	2.21E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	3.23E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	5.64E-09	mr1438_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	1.05E-07	mr1438_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142314165	NA	6.20E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251