Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142082183:

Variant ID: vg0142082183 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42082183
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

GTACGAGTCATGTACTCATGTATGCTTTTAGCATTTATACTGTTATGGTCTTTATCACTGAAGGATTGTTTTGATCTATCAGATTACGGTTGCATTCAGA[A/G]
GTGACAGATCGAGTGTCAAATTAGAACACTTAATGCTCATATGCGCCAGCAAGACTCTGCTGCCGAATGCTCAATCTTTTTCACACAATGAATGTTCAAT

Reverse complement sequence

ATTGAACATTCATTGTGTGAAAAAGATTGAGCATTCGGCAGCAGAGTCTTGCTGGCGCATATGAGCATTAAGTGTTCTAATTTGACACTCGATCTGTCAC[T/C]
TCTGAATGCAACCGTAATCTGATAGATCAAAACAATCCTTCAGTGATAAAGACCATAACAGTATAAATGCTAAAAGCATACATGAGTACATGACTCGTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	8.10%	0.17%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	76.10%	23.30%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	94.90%	4.70%	0.39%	0.00%	NA
Tropical Japonica	504	51.80%	47.40%	0.79%	0.00%	NA
Japonica Intermediate	241	67.20%	32.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142082183	A -> G	LOC_Os01g72540.1	upstream_gene_variant ; 3046.0bp to feature; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg0142082183	A -> G	LOC_Os01g72570.1	upstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg0142082183	A -> G	LOC_Os01g72570.2	upstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg0142082183	A -> G	LOC_Os01g72570.3	upstream_gene_variant ; 4292.0bp to feature; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg0142082183	A -> G	LOC_Os01g72550.1	downstream_gene_variant ; 1627.0bp to feature; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N
vg0142082183	A -> G	LOC_Os01g72560.1	intron_variant ; MODIFIER	silent_mutation	Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142082183	6.33E-06	NA	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183	NA	3.75E-19	Grain_length	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183	9.39E-09	1.30E-15	Grain_weight	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183	NA	6.43E-07	Grain_weight	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183	NA	2.37E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183	NA	5.13E-08	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183	NA	1.26E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183	NA	9.70E-07	mr1851	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183	NA	6.43E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183	NA	3.73E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251