Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142061158:

Variant ID: vg0142061158 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 42061158
Reference Allele: A	Alternative Allele: T,AAT,ATTT,AT,ATTTTT,ATT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTTCGATTTCTTATTTTTGTTACAACTTGTAGAAATTAAATTTAAAATTGCATGTCTGGGGTAACATATTGCATAAGTATCTATCTTATCAAAAAAAA[A/T,AAT,ATTT,AT,ATTTTT,ATT]
TTAACCATTTAACTAGTTGACATGTAATAAATAGTTGGATATTCACCTAGGTGACTTGCTAAAAGTATTTCGCCATCCGTTTTCAATTGCATGTGCTCTA

Reverse complement sequence

TAGAGCACATGCAATTGAAAACGGATGGCGAAATACTTTTAGCAAGTCACCTAGGTGAATATCCAACTATTTATTACATGTCAACTAGTTAAATGGTTAA[T/A,ATT,AAAT,AT,AAAAAT,AAT]
TTTTTTTTGATAAGATAGATACTTATGCAATATGTTACCCCAGACATGCAATTTTAAATTTAATTTCTACAAGTTGTAACAAAAATAAGAAATCGAACTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	23.20%	0.53%	0.00%	AAT: 2.18%; ATTT: 0.38%; AT: 0.32%; ATTTTT: 0.04%
All Indica	2759	94.60%	3.40%	0.36%	0.00%	ATTT: 0.58%; AAT: 0.58%; AT: 0.43%
All Japonica	1512	35.10%	64.50%	0.26%	0.00%	ATTT: 0.13%; AAT: 0.07%
Aus	269	69.10%	0.40%	2.97%	0.00%	AAT: 26.39%; AT: 1.12%
Indica I	595	88.70%	7.70%	0.50%	0.00%	ATTT: 2.35%; AAT: 0.67%
Indica II	465	97.00%	2.60%	0.22%	0.00%	AAT: 0.22%
Indica III	913	97.80%	0.40%	0.11%	0.00%	AT: 1.31%; AAT: 0.22%; ATTT: 0.11%
Indica Intermediate	786	93.90%	4.20%	0.64%	0.00%	AAT: 1.15%; ATTT: 0.13%
Temperate Japonica	767	8.20%	91.10%	0.39%	0.00%	ATTT: 0.26%
Tropical Japonica	504	80.60%	19.00%	0.20%	0.00%	AAT: 0.20%
Japonica Intermediate	241	25.30%	74.70%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	0.00%	0.00%	0.00%	AAT: 13.54%
Intermediate	90	65.60%	26.70%	3.33%	0.00%	AAT: 2.22%; ATTTTT: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142061158	A -> AT	LOC_Os01g72510.1	upstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> AT	LOC_Os01g72520.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> AT	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> T	LOC_Os01g72510.1	upstream_gene_variant ; 574.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> T	LOC_Os01g72520.1	downstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> T	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> AAT	LOC_Os01g72510.1	upstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> AAT	LOC_Os01g72520.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> AAT	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATT	LOC_Os01g72510.1	upstream_gene_variant ; 575.0bp to feature; MODIFIER	N	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATT	LOC_Os01g72520.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	N	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATT	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	N	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTTTT	LOC_Os01g72510.1	upstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTTTT	LOC_Os01g72520.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTTTT	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTT	LOC_Os01g72510.1	upstream_gene_variant ; 575.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTT	LOC_Os01g72520.1	downstream_gene_variant ; 2022.0bp to feature; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N
vg0142061158	A -> ATTT	LOC_Os01g72510-LOC_Os01g72520	intergenic_region ; MODIFIER	silent_mutation	Average:35.471; most accessible tissue: Minghui63 root, score: 50.524	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142061158	NA	1.31E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142061158	NA	9.88E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.33E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	7.31E-07	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.12E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.73E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.78E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.03E-08	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.13E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.78E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	9.07E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.14E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.72E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	9.56E-07	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.02E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.16E-07	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.01E-07	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	3.63E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.94E-08	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.75E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	3.04E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.00E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.31E-08	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.10E-06	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.79E-08	mr1642	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	9.86E-07	mr1677	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	8.10E-06	mr1684	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	5.42E-08	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.70E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.42E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.06E-08	mr1864	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.90E-16	mr1942	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.14E-07	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	7.74E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	7.81E-09	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.09E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	5.67E-08	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	8.60E-06	mr1291_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.51E-06	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	9.79E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	8.91E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.28E-20	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.14E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.34E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.01E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.69E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.17E-13	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.02E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.89E-19	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	2.78E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	9.23E-11	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.57E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	7.02E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.84E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	7.71E-06	mr1928_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.14E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	3.14E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.82E-08	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	1.84E-14	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	5.43E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.15E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.54E-07	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	4.15E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	6.54E-07	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142061158	NA	5.67E-09	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251