Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141996307:

Variant ID: vg0141996307 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41996307
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTCCTGCAACACTTCTTGCAAAATATCATTAGATAGATGAAGTTGGATCAGCGACAGAGCCTTACGATCTTTCCGCTTCTCCTCAGCGGTCCATTCAG[T/C]
CGATTTCTTCTTCCCGAAACTTTCCAGCGCCTCATCAAGATCCGAAGTTTGCGCCAGAACAGCCCGCATCTTGACTTGCCACAGCGAGAATCTCGTCTTG

Reverse complement sequence

CAAGACGAGATTCTCGCTGTGGCAAGTCAAGATGCGGGCTGTTCTGGCGCAAACTTCGGATCTTGATGAGGCGCTGGAAAGTTTCGGGAAGAAGAAATCG[A/G]
CTGAATGGACCGCTGAGGAGAAGCGGAAAGATCGTAAGGCTCTGTCGCTGATCCAACTTCATCTATCTAATGATATTTTGCAAGAAGTGTTGCAGGAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.50%	28.70%	2.05%	4.70%	NA
All Indica	2759	41.80%	47.80%	3.23%	7.25%	NA
All Japonica	1512	96.70%	1.40%	0.46%	1.46%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	58.00%	25.70%	6.05%	10.25%	NA
Indica II	465	16.80%	75.10%	2.58%	5.59%	NA
Indica III	913	38.30%	54.40%	2.52%	4.71%	NA
Indica Intermediate	786	48.20%	40.60%	2.29%	8.91%	NA
Temperate Japonica	767	99.30%	0.50%	0.13%	0.00%	NA
Tropical Japonica	504	91.50%	3.00%	1.19%	4.37%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141996307	T -> DEL	LOC_Os01g72400.1	N	frameshift_variant	Average:29.682; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	N	N	N	N
vg0141996307	T -> C	LOC_Os01g72400.1	missense_variant ; p.Thr47Ala; MODERATE	nonsynonymous_codon ; T47A	Average:29.682; most accessible tissue: Zhenshan97 flag leaf, score: 53.034	benign	1.143	TOLERATED	0.63

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141996307	NA	1.97E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	2.92E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	5.26E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	1.62E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	4.27E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	3.57E-08	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	4.50E-08	mr1520	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	9.25E-07	mr1520	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	3.95E-06	mr1607	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	3.62E-07	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	7.61E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	7.48E-06	2.34E-10	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	2.59E-06	2.15E-11	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	7.14E-08	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141996307	NA	1.40E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251