Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141576432:

Variant ID: vg0141576432 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41576432
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGCTTCAAAATGCCTATCAATAAAATGTTCTGATTAGAGTCTTTATGCAAGCTCGGATATTCAACTGATAAGTGAACTGAGTGCTGAACAAAAGGACT[G/A]
AAGCTATAGCTTACCTACGAAACATGGACTCATCCACGGACTGCGGAATTCGAGCAACAAATATTCTAGTAGCCTTTTTTGATCCCTGTGATTTCATTTC

Reverse complement sequence

GAAATGAAATCACAGGGATCAAAAAAGGCTACTAGAATATTTGTTGCTCGAATTCCGCAGTCCGTGGATGAGTCCATGTTTCGTAGGTAAGCTATAGCTT[C/T]
AGTCCTTTTGTTCAGCACTCAGTTCACTTATCAGTTGAATATCCGAGCTTGCATAAAGACTCTAATCAGAACATTTTATTGATAGGCATTTTGAAGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.40%	5.60%	0.02%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	54.60%	45.00%	0.37%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	76.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141576432	G -> A	LOC_Os01g71760.1	upstream_gene_variant ; 3125.0bp to feature; MODIFIER	silent_mutation	Average:45.349; most accessible tissue: Callus, score: 77.051	N	N	N	N
vg0141576432	G -> A	LOC_Os01g71770.1	intron_variant ; MODIFIER	silent_mutation	Average:45.349; most accessible tissue: Callus, score: 77.051	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141576432	2.85E-07	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	NA	3.01E-10	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	7.52E-06	NA	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	3.26E-08	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	1.67E-06	7.51E-14	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	2.57E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	2.72E-07	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	8.04E-09	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432	5.61E-08	3.87E-14	mr1496_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251