Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141367464:

Variant ID: vg0141367464 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41367464
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTCAAGATGAGCGGCGGGCCGAGCTTGGGACGACTGTTGGAAGAAAGCGATTGCGGGGAGGCGGCAGGAAGAAGGCGCCTAGGACGGTGGAATCGAGA[C/T]
GGTGGGGAGAGAGAACTTGGCTTTGGTAGGGGAAGAAGAGGACCATGCACACCGGTGACGGAGCTCCACTACATTGCATGTGACCTCAATCACGCTGGCC

Reverse complement sequence

GGCCAGCGTGATTGAGGTCACATGCAATGTAGTGGAGCTCCGTCACCGGTGTGCATGGTCCTCTTCTTCCCCTACCAAAGCCAAGTTCTCTCTCCCCACC[G/A]
TCTCGATTCCACCGTCCTAGGCGCCTTCTTCCTGCCGCCTCCCCGCAATCGCTTTCTTCCAACAGTCGTCCCAAGCTCGGCCCGCCGCTCATCTTGAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 32.80% 0.13% 0.28% NA
All Indica  2759 45.10% 54.40% 0.14% 0.40% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.07% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 83.20% 16.50% 0.00% 0.34% NA
Indica II  465 13.10% 85.80% 0.22% 0.86% NA
Indica III  913 33.70% 66.30% 0.00% 0.00% NA
Indica Intermediate  786 48.20% 50.80% 0.38% 0.64% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.40% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141367464 C -> T LOC_Os01g71390.1 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N
vg0141367464 C -> T LOC_Os01g71400.1 upstream_gene_variant ; 3251.0bp to feature; MODIFIER silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N
vg0141367464 C -> T LOC_Os01g71370.1 downstream_gene_variant ; 3610.0bp to feature; MODIFIER silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N
vg0141367464 C -> T LOC_Os01g71380.1 downstream_gene_variant ; 894.0bp to feature; MODIFIER silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N
vg0141367464 C -> T LOC_Os01g71380-LOC_Os01g71390 intergenic_region ; MODIFIER silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N
vg0141367464 C -> DEL N N silent_mutation Average:73.891; most accessible tissue: Callus, score: 94.89 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141367464 C T -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141367464 NA 2.46E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141367464 NA 2.10E-17 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141367464 NA 1.92E-07 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141367464 NA 1.20E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141367464 NA 7.18E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 7.19E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 2.69E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 9.58E-10 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 8.93E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 5.54E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 2.37E-06 NA mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 4.05E-08 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141367464 NA 9.50E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251