Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141047242:

Variant ID: vg0141047242 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41047242
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CATACAAATCGGCCGTATCTTCAGAGAGCAAACAACAACAGCTAGCTGGCGAGTGATATGATCGATAGGGAAGGAGTACTCCTGCATGTCTTGATCGATC[A/G,C]
TACTGGTGGAGAAACCATATTTGGTCGGTCCAACCAAATTCACAATAGTCCCGGTTCCATTAAAAACCGGGACTAAAAAGCATTTTTAGTCCGGTTTATA

Reverse complement sequence

TATAAACCGGACTAAAAATGCTTTTTAGTCCCGGTTTTTAATGGAACCGGGACTATTGTGAATTTGGTTGGACCGACCAAATATGGTTTCTCCACCAGTA[T/C,G]
GATCGATCAAGACATGCAGGAGTACTCCTTCCCTATCGATCATATCACTCGCCAGCTAGCTGTTGTTGTTTGCTCTCTGAAGATACGGCCGATTTGTATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 9.40% 0.04% 0.00% C: 0.04%
All Indica  2759 96.00% 3.80% 0.07% 0.00% C: 0.07%
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 92.80% 6.60% 0.34% 0.00% C: 0.34%
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 5.90% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141047242 A -> G LOC_Os01g70900-LOC_Os01g70920 intergenic_region ; MODIFIER silent_mutation Average:54.058; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N
vg0141047242 A -> C LOC_Os01g70900-LOC_Os01g70920 intergenic_region ; MODIFIER silent_mutation Average:54.058; most accessible tissue: Zhenshan97 panicle, score: 82.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141047242 A C 0.0 0.01 0.01 0.0 0.03 0.05
vg0141047242 A G 0.01 0.02 0.01 0.03 0.07 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141047242 NA 5.90E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141047242 NA 6.69E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141047242 NA 5.67E-06 mr1444 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141047242 NA 2.32E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141047242 NA 1.04E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141047242 NA 5.57E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251