Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140863872:

Variant ID: vg0140863872 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40863872
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTCTTGCACACCGCGCTGCGCGGGCTCTTCATCGTCTTCACGATCGCCAGCATCACCTTGCCACTGCTCGATTAGCCACAAAACCAAATCAAATCAAA[T/C]
TGAAAATCCCACCAACACTTCTCCTGCTCAAAATCAAGAGCAGTGAATTGTGGATGAACTGGAGCGCGTACAGGATGGGGTTGAGGAGGGAGGGGTGGTG

Reverse complement sequence

CACCACCCCTCCCTCCTCAACCCCATCCTGTACGCGCTCCAGTTCATCCACAATTCACTGCTCTTGATTTTGAGCAGGAGAAGTGTTGGTGGGATTTTCA[A/G]
TTTGATTTGATTTGGTTTTGTGGCTAATCGAGCAGTGGCAAGGTGATGCTGGCGATCGTGAAGACGATGAAGAGCCCGCGCAGCGCGGTGTGCAAGACCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	5.20%	0.00%	0.00%	NA
All Indica	2759	98.10%	1.90%	0.00%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	67.70%	32.30%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.60%	2.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140863872	T -> C	LOC_Os01g70550.1	upstream_gene_variant ; 1951.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70550.3	upstream_gene_variant ; 2801.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70550.2	upstream_gene_variant ; 1951.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70570.1	downstream_gene_variant ; 1036.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70580.1	downstream_gene_variant ; 4836.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70570.2	downstream_gene_variant ; 1036.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70570.3	downstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N
vg0140863872	T -> C	LOC_Os01g70560.1	intron_variant ; MODIFIER	silent_mutation	Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140863872	NA	1.30E-08	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140863872	5.63E-08	NA	mr1134_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140863872	NA	2.20E-09	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251