Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140613900:

Variant ID: vg0140613900 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40613900
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAATAAGATGAATGGCTAAATATATTTTAAAAAAATCAACAGCGTCAAATATTTAGGGACAGATGGAGTATATTTTTGTGTCAAACGGTGCTGCCAACT[T/G]
AGCGGAAGATGTGAATGTGTTCGTGAAGATCCGAGTGATTCTTTGGTAGAAGTAGTGTTTAAGTTCTTCTCTATCATTTGAATGTTTCCTTTTTGTATTT

Reverse complement sequence

AAATACAAAAAGGAAACATTCAAATGATAGAGAAGAACTTAAACACTACTTCTACCAAAGAATCACTCGGATCTTCACGAACACATTCACATCTTCCGCT[A/C]
AGTTGGCAGCACCGTTTGACACAAAAATATACTCCATCTGTCCCTAAATATTTGACGCTGTTGATTTTTTTAAAATATATTTAGCCATTCATCTTATTCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	41.10%	0.06%	0.00%	NA
All Indica	2759	74.60%	25.40%	0.00%	0.00%	NA
All Japonica	1512	30.50%	69.40%	0.13%	0.00%	NA
Aus	269	50.90%	49.10%	0.00%	0.00%	NA
Indica I	595	67.70%	32.30%	0.00%	0.00%	NA
Indica II	465	88.80%	11.20%	0.00%	0.00%	NA
Indica III	913	80.10%	19.90%	0.00%	0.00%	NA
Indica Intermediate	786	65.00%	35.00%	0.00%	0.00%	NA
Temperate Japonica	767	48.40%	51.60%	0.00%	0.00%	NA
Tropical Japonica	504	10.90%	89.10%	0.00%	0.00%	NA
Japonica Intermediate	241	14.50%	84.60%	0.83%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140613900	T -> G	LOC_Os01g70170.1	upstream_gene_variant ; 437.0bp to feature; MODIFIER	silent_mutation	Average:53.703; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0140613900	T -> G	LOC_Os01g70160.1	downstream_gene_variant ; 3559.0bp to feature; MODIFIER	silent_mutation	Average:53.703; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0140613900	T -> G	LOC_Os01g70180.1	downstream_gene_variant ; 1800.0bp to feature; MODIFIER	silent_mutation	Average:53.703; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0140613900	T -> G	LOC_Os01g70180.2	downstream_gene_variant ; 1800.0bp to feature; MODIFIER	silent_mutation	Average:53.703; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0140613900	T -> G	LOC_Os01g70170-LOC_Os01g70180	intergenic_region ; MODIFIER	silent_mutation	Average:53.703; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140613900	2.89E-06	2.88E-06	mr1205	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	7.71E-06	7.71E-06	mr1353	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	6.08E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	7.93E-06	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	8.57E-06	mr1637	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	6.89E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	7.40E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	1.07E-06	1.07E-06	mr1894	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	5.50E-06	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140613900	NA	1.60E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251