Search for Variation information by Variation ID:
Detailed information for vg0140513804:
| Variant ID: vg0140513804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40513804 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
ATATAGAAAAATAGACATGTATTAAATACAATCCATTTTGATGTCCTAGCTAGCTACGATTTCGACGTAGTAGTAGTCGTTATCTCAGAAGCTAATGACC[T/A]
ATGAATTGTATTTCCGTCGTAGTAGAATTCACCCTTGGGATCAAGGATTTGTTCGTTGATGAATCCCATGAGTTGTTCTTGAACCGCCGCGATAAATTCC
Reverse complement sequence
GGAATTTATCGCGGCGGTTCAAGAACAACTCATGGGATTCATCAACGAACAAATCCTTGATCCCAAGGGTGAATTCTACTACGACGGAAATACAATTCAT[A/T]
GGTCATTAGCTTCTGAGATAACGACTACTACTACGTCGAAATCGTAGCTAGCTAGGACATCAAAATGGATTGTATTTAATACATGTCTATTTTTCTATAT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.40% | 8.60% | 0.99% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.60% | 26.30% | 3.04% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 56.20% | 37.80% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.80% | 33.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140513804 | T -> A | LOC_Os01g70030.1 | missense_variant ; p.Arg884Trp; MODERATE | nonsynonymous_codon ; R884W | Average:15.025; most accessible tissue: Zhenshan97 panicle, score: 24.575 | probably damaging  |
3.089 |
DELETERIOUS | 0.01 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140513804 | NA | 7.94E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140513804 | 1.61E-06 | 1.61E-06 | mr1621 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140513804 | 4.53E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140513804 | NA | 7.33E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |