Search for Variation information by Variation ID:
Detailed information for vg0139382231:
| Variant ID: vg0139382231 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39382231 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )
Flanking Sequence (100 bp) in Reference Genome:
GTCCTCGTACCACAACTCCAAATGATCGAGGGACACCTACTCACCGGTTCTCAACCAGTTGATCGTAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGA[A/G]
TTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTTTCTCCGGCTACTTCCGCTTTAAGTGGTCAAGTTACGACTACTGCCTGGTTCTCGACCAGC
Reverse complement sequence
GCTGGTCGAGAACCAGGCAGTAGTCGTAACTTGACCACTTAAAGCGGAAGTAGCCGGAGAAACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAA[T/C]
TCGACCACTTGAAGCAAATGTACGAGAGATCACTACGATCAACTGGTTGAGAACCGGTGAGTAGGTGTCCCTCGATCATTTGGAGTTGTGGTACGAGGAC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.70% | 21.00% | 13.48% | 20.78% | NA |
| All Indica | 2759 | 58.70% | 2.00% | 5.47% | 33.89% | NA |
| All Japonica | 1512 | 26.70% | 60.60% | 12.43% | 0.33% | NA |
| Aus | 269 | 4.50% | 1.10% | 83.27% | 11.15% | NA |
| Indica I | 595 | 32.30% | 2.50% | 3.03% | 62.18% | NA |
| Indica II | 465 | 88.80% | 0.40% | 3.23% | 7.53% | NA |
| Indica III | 913 | 54.70% | 0.80% | 6.79% | 37.79% | NA |
| Indica Intermediate | 786 | 65.50% | 3.80% | 7.12% | 23.54% | NA |
| Temperate Japonica | 767 | 10.40% | 86.20% | 3.26% | 0.13% | NA |
| Tropical Japonica | 504 | 56.70% | 12.90% | 29.96% | 0.40% | NA |
| Japonica Intermediate | 241 | 15.40% | 78.80% | 4.98% | 0.83% | NA |
| VI/Aromatic | 96 | 31.20% | 3.10% | 63.54% | 2.08% | NA |
| Intermediate | 90 | 54.40% | 20.00% | 14.44% | 11.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139382231 | A -> G | LOC_Os01g67760.1 | missense_variant ; p.Asn127Ser; MODERATE | nonsynonymous_codon | Average:11.825; most accessible tissue: Callus, score: 34.369 | benign  |
-1.386 |
TOLERATED | 1.00 |
| vg0139382231 | A -> DEL | LOC_Os01g67760.1 | N | frameshift_variant | Average:11.825; most accessible tissue: Callus, score: 34.369 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139382231 | NA | 3.72E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 1.94E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 3.56E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 2.31E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 2.22E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 6.18E-06 | mr1625 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 1.71E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 4.96E-10 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | 6.73E-07 | 6.73E-07 | mr1815 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 5.76E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139382231 | NA | 4.78E-07 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |