Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139256874:

Variant ID: vg0139256874 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39256874
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTGTAGAATCTGTAATATGTTTTTTGGACCGAGGTAGAATGCAGCTATTGGATTGAGATCCTCTACCGTAACTTTCATATGACGTGGTGGCTGACAT[A/G]
TTGGCCCGGAAGTGGTGGAGTCGACATACATGGTGGCTGAAATGTCGGTCCAGAAGTGGTGGAGTCGACATGTCAATTACGGTGAACAGTAACATCGGAG

Reverse complement sequence

CTCCGATGTTACTGTTCACCGTAATTGACATGTCGACTCCACCACTTCTGGACCGACATTTCAGCCACCATGTATGTCGACTCCACCACTTCCGGGCCAA[T/C]
ATGTCAGCCACCACGTCATATGAAAGTTACGGTAGAGGATCTCAATCCAATAGCTGCATTCTACCTCGGTCCAAAAAACATATTACAGATTCTACACTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 7.60% 3.32% 0.00% NA
All Indica  2759 99.30% 0.30% 0.36% 0.00% NA
All Japonica  1512 68.10% 22.40% 9.59% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.20% 0.84% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.50% 0.64% 0.00% NA
Temperate Japonica  767 46.70% 39.50% 13.82% 0.00% NA
Tropical Japonica  504 93.80% 2.20% 3.97% 0.00% NA
Japonica Intermediate  241 82.20% 10.00% 7.88% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139256874 A -> G LOC_Os01g67540.1 upstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:77.203; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0139256874 A -> G LOC_Os01g67530.1 downstream_gene_variant ; 121.0bp to feature; MODIFIER silent_mutation Average:77.203; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0139256874 A -> G LOC_Os01g67530-LOC_Os01g67540 intergenic_region ; MODIFIER silent_mutation Average:77.203; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139256874 A G 0.02 0.01 -0.01 0.02 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139256874 NA 1.77E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139256874 NA 8.95E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139256874 NA 5.82E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 1.21E-07 4.69E-23 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 4.81E-06 1.72E-12 mr1163 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 9.59E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 5.91E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 5.16E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 8.63E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 1.39E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 2.87E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 2.54E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 9.42E-23 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 2.44E-13 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 7.34E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 6.50E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 9.54E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 1.73E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 5.95E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 3.08E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 1.59E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 6.97E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 9.90E-11 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139256874 NA 3.00E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251