Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138932968:

Variant ID: vg0138932968 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 38932968
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCATATATGTTAGTTATGACATCGTAATTTCTAGTCTTCATACAGCTCCAGTTATTGAAATAAAAAGTTACCTTTTTGGCATGAACATCCTTAATCTT[G/A]
CGAGGAGGGAGGATGTCCCAGTCAGTGTACATGCTCCCTGATTCTCTTTCACGGTTATCAACTAGTATGCTATAGGACGCATCAGGCCTTAGTATGAATG

Reverse complement sequence

CATTCATACTAAGGCCTGATGCGTCCTATAGCATACTAGTTGATAACCGTGAAAGAGAATCAGGGAGCATGTACACTGACTGGGACATCCTCCCTCCTCG[C/T]
AAGATTAAGGATGTTCATGCCAAAAAGGTAACTTTTTATTTCAATAACTGGAGCTGTATGAAGACTAGAAATTACGATGTCATAACTAACATATATGCCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.60%	30.00%	0.15%	0.25%	NA
All Indica	2759	99.20%	0.50%	0.14%	0.11%	NA
All Japonica	1512	8.50%	91.00%	0.20%	0.33%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.20%	0.34%	0.34%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	99.50%	0.40%	0.13%	0.00%	NA
Temperate Japonica	767	4.20%	95.60%	0.00%	0.26%	NA
Tropical Japonica	504	14.90%	84.50%	0.20%	0.40%	NA
Japonica Intermediate	241	8.70%	90.00%	0.83%	0.41%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	65.60%	30.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0138932968	G -> A	LOC_Os01g67054.1	synonymous_variant ; p.Arg234Arg; LOW	synonymous_codon	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N
vg0138932968	G -> A	LOC_Os01g67054.3	synonymous_variant ; p.Arg142Arg; LOW	synonymous_codon	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N
vg0138932968	G -> A	LOC_Os01g67054.2	synonymous_variant ; p.Arg234Arg; LOW	synonymous_codon	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N
vg0138932968	G -> DEL	LOC_Os01g67054.1	N	frameshift_variant	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N
vg0138932968	G -> DEL	LOC_Os01g67054.2	N	frameshift_variant	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N
vg0138932968	G -> DEL	LOC_Os01g67054.3	N	frameshift_variant	Average:61.231; most accessible tissue: Callus, score: 82.131	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0138932968	G	A	-0.02	-0.02	-0.03	-0.02	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0138932968	5.15E-07	NA	Grain_thickness	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138932968	NA	5.29E-54	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138932968	NA	6.47E-22	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	3.94E-46	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	5.10E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	5.44E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	7.11E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	1.59E-82	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	1.00E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	1.25E-52	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	4.72E-20	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	2.24E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	4.30E-17	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	4.87E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138932968	NA	2.63E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251