Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138585164:

Variant ID: vg0138585164 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38585164
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ATATCAGGGAGGCTGGAAGTATGGGAGCAAGCATGGCATTAGCTATGACCAAATCTTTATACCCCAAAATCGATATCGACGCCGTTGACGGGTTCGCAGA[C/T]
GGGACAAGCGAAGAAACAGCCCTCAACCACATCAATGATGCACAAAAAGCCACTGACAAGATTGCTGCTGACGTAGTTGAGAGATTCCAAGATGTCGACC

Reverse complement sequence

GGTCGACATCTTGGAATCTCTCAACTACGTCAGCAGCAATCTTGTCAGTGGCTTTTTGTGCATCATTGATGTGGTTGAGGGCTGTTTCTTCGCTTGTCCC[G/A]
TCTGCGAACCCGTCAACGGCGTCGATATCGATTTTGGGGTATAAAGATTTGGTCATAGCTAATGCCATGCTTGCTCCCATACTTCCAGCCTCCCTGATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.60% 28.30% 1.12% 0.00% NA
All Indica  2759 55.60% 43.00% 1.45% 0.00% NA
All Japonica  1512 96.70% 3.20% 0.07% 0.00% NA
Aus  269 71.40% 26.00% 2.60% 0.00% NA
Indica I  595 63.00% 32.40% 4.54% 0.00% NA
Indica II  465 4.90% 94.00% 1.08% 0.00% NA
Indica III  913 76.60% 23.10% 0.33% 0.00% NA
Indica Intermediate  786 55.60% 43.80% 0.64% 0.00% NA
Temperate Japonica  767 96.70% 3.10% 0.13% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 2.10% 2.08% 0.00% NA
Intermediate  90 62.20% 34.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138585164 C -> T LOC_Os01g66450.1 synonymous_variant ; p.Asp636Asp; LOW synonymous_codon Average:27.372; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138585164 NA 5.32E-18 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138585164 4.47E-07 7.89E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138585164 NA 3.29E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 7.94E-08 mr1011 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 4.67E-06 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.21E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 4.94E-07 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 3.13E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.46E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 6.05E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.29E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 2.72E-08 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 8.06E-08 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 5.74E-06 mr1755 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.15E-08 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.46E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 5.63E-09 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 6.57E-12 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 6.12E-14 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 3.08E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.98E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 5.02E-17 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 6.45E-08 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.25E-09 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 1.04E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 7.69E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 4.12E-06 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 3.28E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138585164 NA 2.66E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251